Lentiviral Strategies for RNAi Knockdown of Neuronal Genes

Jill R. Crittenden1, Amy Heidersbach2, Michael T. McManus2

1 Massachusetts Institute of Technology, Cambridge, Massachusetts, 2 University of California, San Francisco, San Francisco, California
Publication Name:  Current Protocols in Neuroscience
Unit Number:  Unit 5.26
DOI:  10.1002/0471142301.ns0526s39
Online Posting Date:  April, 2007
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

RNA interference (RNAi) refers to the process by which 21‐ to 23‐nucleotide short interfering RNAs (siRNAs) mediate post‐transcriptional degradation of homologous mRNA transcripts. This process is carried out by an endogenous pathway that centers on the use of endogenously encoded small RNAs, and can be hijacked to knock down the expression of any target protein by introducing a specific siRNA into a cell. Stable knockdown can be obtained by constitutive expression of the siRNA from the host chromosome. Retroviruses, such as lentivirus, provide a convenient vector by which to integrate RNAi expression constructs. Lentiviruses can infect nondividing cells, thereby allowing knockdown in cells such as mature neurons. This unit provides methods to design and clone siRNAs into a lentiviral vector. Additional protocols describe production and titering of the lentivirus, as well as safety testing. Finally, methods are provided for infecting neurons in culture and in vivo with RNAi lentivirus.

Keywords: siRNA; RNAi; knockdown; gene‐silencing; lentivirus

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Infection of Primary Neuronal Cultures with Lentivurus
  • Support Protocol 1: Cloning a Short Hairpin Sequence into a Lentivirus Plasmid
  • Support Protocol 2: Production of shRNA‐Expressing Virus
  • Support Protocol 3: Concentration of VSV/G‐Pseudotyped Virus by Ultracentrifugation
  • Support Protocol 4: Estimation of Viral Titer
  • Support Protocol 5: Lentiviral Replication Check
  • Basic Protocol 2: Stereotaxic Injection of Lentivirus
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Infection of Primary Neuronal Cultures with Lentivurus

  Materials
  • Nitric acid, concentrated
  • Slide‐coating solution (see recipe)
  • Primary neuronal cell culture media (see recipe), with and without glutamate
  • E18 timed pregnant rat (Sprague‐Dawley strain or any strain/age available commercially; litters with fewer than four fetuses may indicate unhealthy pregnancy and are therefore suboptimal)
  • Hanks' buffered salt solution (HBSS; appendix 2A), ice cold
  • 2.5% (w/v) trypsin type XI (Sigma) in HBSS
  • 1% (w/v) DNase I, type IV (Sigma) in HBSS
  • Lentivirus engineered to express desired RNAi vector ( protocol 3)
  • 22‐mm coverslips (e.g., Carolina Biological Supply)
  • 100‐mm beaker
  • Platform shaker
  • Forceps, sterile
  • 60‐mm plastic petri dishes
  • Pasteur pipets, normal and fire‐polished to one‐half original diameter
  • Tabletop centrifuge (e.g., IEC Clinical)
  • Additional reagents and equipment for euthanasia of the rat ( appendix 4H), dissection of E18 rat embryos to obtain hippocampal neurons (unit 3.2) and cell culture techniques including counting cells ( appendix 3B)
NOTE: All solutions and equipment coming into contact with live cells must be sterile, and proper aseptic technique should be used accordingly.NOTE: All culture incubations are performed in a humidified 37°C, 5% CO 2 incubator unless otherwise specified.

Support Protocol 1: Cloning a Short Hairpin Sequence into a Lentivirus Plasmid

  Materials
  • Reverse and forward DNA oligonucleotides (gel purified and 5′‐phosphorylated):
    • Forward: 5′‐phos‐TGCAAGCTGACCCTGAAGTCTCAAGAGAGAACTCAGGGTCAGCTGCTTTC
    • Reverse: 5′‐phos‐TCGAGAAAAAAGCAAGCTGACCCTGAAGTCTCTCTGAAGAACTCAGGGTCAGCTGCA
  • 20× SSC ( appendix 2A)
  • pLentilox‐derived lentivirus cloning vector (ATCC) such as pSico series (containing HpaI and XhoI restriction sites)
  • HpaI, XbaI, and XhoI restriction endonucleases (e.g., New England Biolabs; also see appendix 1M)
  • 1% agarose gel ( appendix 1N) in TBE buffer ( appendix 2A)
  • 2000 U/µl T4 DNA ligase and 10× DNA ligase buffer (e.g., New England Biolabs; also see CPMB UNIT )
  • Chemically competent E. coli DH5α cells (Invitrogen)
  • LB plates containing ampicillin ( appendix 2A)
  • DNA miniprep kit (e.g., Qiagen)
  • DNA midi‐ or maxiprep kit (endotoxin free; e.g., Qiagen)
  • 94°C water bath
  • Sterile toothpicks
  • Additional reagents and equipment for restriction enzyme digestion ( appendix 1M), agarose gel electrophoresis ( appendix 1N), use of T4 DNA ligase (CPMB UNIT ), and introduction of plasmid DNA into competent E. coli ( appendix 1L)
CAUTION: Be aware of the local safety policies regarding construction of human‐targeted genes in lentiviruses. For example, higher level BSL lab status may be required if cloning hairpins against human tumor suppressors. Always consult with the local biosafety office before starting experiments.

Support Protocol 2: Production of shRNA‐Expressing Virus

  Materials
  • 293T cells (e.g., ATCC)
  • Complete Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS ( appendix 2A)
  • Serum‐free DMEM medium (e.g., Invitrogen)
  • pMD.G (encoding the VSV‐G envelope; http://www.tronolab.unige.ch)
  • pRSV (encoding the HIV‐1 Rev protein; http://www.tronolab.unige.ch)
  • pMDLgag (encoding the HIV‐1 Gag and Pol proteins; http://www.tronolab.unige.ch)
  • pLentilox vector containing short hairpin sequence ( protocol 2)
  • Fugene transfection reagent (Roche)
  • 6‐well tissue culture plates and 10‐cm tissue culture dishes
  • Inverted fluorescence microscope with GFP optics
  • 0.45 µm syringe filters (e.g., Acrodisc from PALL)
  • 10‐ml syringe
  • Additional reagents and equipment for mammalian cell culture ( appendix 3B)
NOTE: All solutions and equipment coming into contact with live cells must be sterile, and proper aseptic technique should be used accordingly.NOTE: All culture incubations are performed in a humidified 37°C, 5% CO 2 incubator unless otherwise specified.

Support Protocol 3: Concentration of VSV/G‐Pseudotyped Virus by Ultracentrifugation

  Materials
  • Virus‐transfected 293T cells growing in culture ( protocol 3)
  • Serum‐free DMEM (e.g., Invitrogen)
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • 10% bleach for decontamination
  • 10‐ml syringe
  • 0.45‐µm syringe filters (e.g., Acrodisc from PALL)
  • Ultraclear SW 41 centrifuge tubes (Beckman)
  • Beckman ultracentrifuge with SW 41 rotor
  • Forceps

Support Protocol 4: Estimation of Viral Titer

  Materials
  • 293T cells (ATCC)
  • Complete Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS ( appendix 2A)
  • Viral stock to be titered ( protocol 4)
  • 10% bleach for decontamination
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • 0.05% (w/v) trypsin/EDTA (Invitrogen)
  • 24‐well tissue culture plates (e.g., Falcon)
  • Flow cytometer and appropriate flow cytometry tubes
  • Additional reagents and equipment for flow cytometry (Robinson et al., )

Support Protocol 5: Lentiviral Replication Check

  Materials
  • 293T cells in 6‐well tissue culture plates
  • Lentivirus sample ( protocol 4)
  • Complete Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS ( appendix 2A)
  • Flow cytometer and appropriate FACS tubes
  • 0.45‐µm syringes filters (e.g., Acrodisc from PALL)
  • 5‐ to 10‐ml syringe

Basic Protocol 2: Stereotaxic Injection of Lentivirus

  Materials
  • Sterile 0.9% (w/v) sodium chloride
  • Betadine (e.g., Samuel Perkins)
  • 70% ethanol
  • Anesthetic solution (see recipe)
  • Booster anesthetic solution (see recipe)
  • Lentivirus engineered to express desired RNAi vector ( protocol 3)
  • Adult mouse
  • Ophthalmic lubricating ointment (e.g., Lacri‐Lube)
  • Lukens sterile bone wax (e.g., Samuel Perkins)
  • Triple antibiotic ointment
  • Buprenorphine HCl (Reckitt & Colman Limited; http://www.reckitt.com/)
  • Stereotaxic apparatus for mice (e.g., Stoelting) with 45° ear bars
  • 1‐ or 2‐µl Hamilton syringe
  • Fiber‐optic light source
  • Stereomicroscope on flexible stand
  • Handheld bone drill with foot‐pedal variable speed control (e.g., Dremel)
  • 0.9‐mm steel burrs (e.g., Fine Science Tools)
  • Surgical instruments, sterile:
    • Halsted mosquito hemostat, straight (e.g., Fine Science Tools)
    • Bard‐Parker #3 scalpel handle
    • Bard‐Parker #15 scalpel blades, sterile (e.g., Samuel Perkins)
    • Forceps
    • Schwartz micro‐serrefine straight clamps (e.g., Fine Science Tools)
    • Dissecting probe, hooked tip (e.g., Fine Science Tools)
  • Sterile cotton swabs and gauze
  • 6‐0 Ethicon silk suture, 18 in.
  • P‐1 needle (e.g., Samuel Perkins)
  • Temperature therapy pump (e.g., J.A. Webster)
  • Temperature therapy heavy‐duty heating pad (e.g., J.A. Webster)
  • 1‐ml syringes
  • 30‐G syringe needles
  • Electric clippers
  • Mouse brain atlas (e.g., Paxinos and Franklin, ) to determine coordinates for injection site
  • Mouse cages
  • Additional reagents and equipment for injection of the mouse ( appendix 4F)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •   FigureFigure 5.26.1 Generating the short hairpin RNA insert for cloning into the lentivirus. There are many ways to prepare the shRNA construct for cloning: four strategies are shown here. (A) In the “double‐primer” method, two long oligos are synthesized and annealed to create the shRNA insert. This product may be cloned directly. (B) “Train‐car” approach, where four short 5′‐phosphorylated oligos are designed with the appropriate sticky ends and are ligated directly into the vector (a four‐way ligation). (C) The primer‐dimer method uses two oligos that are complementary in the loop region. After PCR, the oligos are restriction digested and directly cloned. (D) A long oligo can be used as a template to amplify the dsDNA to be cloned. Here, two short primers containing the restriction site are used in the amplification. (E) In the 5′‐extension oligo method, the short hairpin gene is added to the 5′‐end of a U6 3′ primer. In this strategy, the above primers are used to amplify the U6 promoter. Following amplification the PCR product is digested with the restriction enzyme(s) and cloned.
  •   FigureFigure 5.26.2 Production of shRNA‐encoding lentivirus. Typically 293T cells (or another easily infectable cell line) are cotransfected with four plasmids. Three of these four plasmids encode lentiviral packaging proteins while the fourth encodes the short hairpin sequence and a reporter gene. The virus‐containing medium supernatant is harvested (36 to 70 hr later) from the transfected cells and is titered and used in experiments. Alternatively, the supernatant may be concentrated and then titered.
  •   FigureFigure 5.26.3 GFP knockdown by a lentivirus encoding a shRNA against GFP. Example of knockdown that can be achieved by lentivirally encoded shRNAs. Dashed line represents cells infected with a lentivirus encoding an shRNA against GFP, and the solid line represents cells infected with a lentivirus without an shRNA.
  •   FigureFigure 5.26.4 Stereotaxic injection of lentivirus into mouse brain. Cartoon depicting preparation for intracranial virus injection into the mouse forebrain using a 1‐µl Hamilton syringe; stereotactic apparatus is not shown.

Videos

Literature Cited

   Bernards, R., Brummelkamp, T.R., and Beijersbergen, R.L. 2006. shRNA libraries and their use in cancer genetics. Nat. Methods 3:701‐706.
   Bowles, N.E., Eisensmith, R.C., Mohuiddin, R., Pyron, M., and Woo, S.L. 1996. A simple and efficient method for the concentration and purification of recombinant retrovirus for increased hepatocyte transduction in vivo. Hum. Gene Ther. 7:1735–1742.
   Brummelkamp, T.R., Bernards, R., and Agami, R. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296:550‐553.
   Buchholz, F., Kittler, R., Slabicki, M., and Theis, M. 2006. Enzymatically prepared RNAi libraries. Nat. Methods 3:696‐700.
   Carmell, M.A., Zhang, L., Conklin, D.S., Hannon, G.J., and Rosenquist, T.A. 2003. Germline transmission of RNAi in mice. Nat. Struct. Biol. 10:91‐92.
   Cottrell, J.R., Borok, E., Horvath, T.L., and Nedivi, E. 2004. CPG2: A brain‐ and synapse‐specific protein that regulates the endocytosis of glutamate receptors. Neuron 44:677‐690.
   Donello, J.E., Loeb, J.E., and Hope, T.J. 1998. Woodchuck hepatitis virus contains a tripartite posttranscriptional regulatory element. J. Virol. 72:5085‐5092.
   Dykxhoorn, D.M., Novina, C.D., and Sharp, P.A. 2003. Killing the messenger: Short RNAs that silence gene expression. Nat. Rev. Mol. Cell Biol. 4:457‐467.
   Follenzi, A., Ailles, L.E., Bakovic, S., Geuna, M., and Naldini, L. 2000. Gene transfer by lentiviral vectors is limited by nuclear translocation and rescued by HIV‐1 pol sequences. Nat. Genet. 25:217‐222.
   Geraerts, M., Willems, S., Baekelandt, V., Debyser, Z., and Gijsbers, R. 2006. Comparison of lentiviral vector titration methods. BMC Biotech. 6:34.
   Iwakuma, T., Cui, Y., and Chang, L.J. 1999. Self‐inactivating lentiviral vectors with U3 and U5 modifications. Virology 261:120‐132.
   Jackson, A.L., Bartz, S.R., Schelter, J., Kobayashi, S.V., Burchard, J., Mao, M., Li, B., Cavet, G., and Linsley, P.S. 2003. Expression profiling reveals off‐target gene regulation by RNAi. Nat. Biotechnol. 21:635‐637.
   Khvorova, A., Reynolds, A., and Jayasena, S.D. 2003. Functional siRNAs and miRNAs exhibit strand bias.Cell 115:209‐216.
   Kubota, Y., Liu, J., DeCoteau, W.E., and Graybiel, A.M. 2004. Sub‐populations of mouse striatal neurons exhibit response plasticity during successive training on two procedural T‐maze tasks. Soc. Neurosci. Abstr. 30:70.5.
   Kunath, T., Gish, G., Lickert, H., Jones, N., Pawson, T., and Rossant, J. 2003. Transgenic RNA interference in ES cell–derived embryos recapitulates a genetic null phenotype. Nat. Biotechnol. 21:559‐561.
   McManus, M.T. and Sharp, P.A. 2002. Gene silencing in mammals by small interfering RNAs. Nat. Rev. Genet. 3:737‐747.
   McManus, M.T., Petersen, C.P., Haines, B.B., Chen, J., and Sharp, P.A. 2002. Gene silencing using micro‐RNA designed hairpins. RNA 8:842‐850.
   Miyagishi, M. and Taira, K. 2002. U6 promoter‐driven siRNAs with four uridine 3′ overhangs efficiently suppress targeted gene expression in mammalian cells. Nat. Biotechnol. 20:497‐500.
   Paddison, P.J., Caudy, A.A., Bernstein, E., Hannon, G.J., and Conklin, D.S. 2002. Short hairpin RNAs (shRNAs) induce sequence‐specific silencing in mammalian cells. Genes. Dev. 16:948‐958.
   Paul, C.P., Good, P.D., Winer, I., and Engelke, D.R. 2002. Effective expression of small interfering RNA in human cells. Nat. Biotechnol. 20:505‐508.
   Paxinos, G. and Franklin, K.B.J. 2001. The Mouse Brain in Stereotaxic Coordinates, Second Edition, Elsevier, New York.
   Reynolds, A., Leake, D., Boese, Q., Scaringe, S., Marshall, W.S., and Khvorova, A. 2004. Rational siRNA design for RNA interference. Nat. Biotechnol. 22:326‐330.
   Robinson, J.P., Darzynkiewiciz, Z., Dobrucki, J., Hoffman, R., Nolan, J.P., Orfao, A., Rabinovitch, P.S., and Shapiro, H (eds.). 2007. Current Protocols in Cytometry. John Wiley & Sons, Hoboken, N.J.
   Root, D.E., Hacohen, N., Hahn, W.C., Lander, E.S., and Sabatini, D.M. 2006. Genome‐scale loss‐of‐function screening with a lentiviral RNAi library. Nat. Methods. 3:715‐719.
   Rubinson, D.A., Dillon, C.P., Kwiatkowski, A.V., Sievers, C., Yang, L., Kopinja, J., Rooney, D.L., Ihrig, M.M., McManus, M.T., Gertler, F.B., Scott, M.L., and Van Parijs, L. 2003. A lentivirus‐based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat. Genet. 33:401‐406.
   Sandy, P., Ventura, A., and Jacks, T. 2005. Mammalian RNAi: A practical guide. Biotechniques 39:215‐224.
   Schwarz, D.S., Hutvagner, G., Du, T., Xu, Z., Aronin, N., and Zamore, P.D. 2003. Asymmetry in the assembly of the RNAi enzyme complex. Cell 115:199‐208.
   Tiscornia, G., Tergaonkar, V., Galimi, F., and Verma, I.M. 2004. CRE recombinase–inducible RNA interference mediated by lentiviral vectors. Proc. Natl. Acad. Sci. U.S.A. 101:7347‐7351.
   Ventura, A., Meissner, A., Dillon, C.P., McManus, M., Sharp, P.A., Van Parijs, L., Jaenisch, R., and Jacks, T. 2004. Cre‐lox‐regulated conditional RNA interference from transgenes. Proc. Natl. Acad. Sci. U.S.A. 101:10380‐10385.
   Xia, H., Mao, Q., Paulson, H.L., and Davidson, B.L. 2002. siRNA‐mediated gene silencing in vitro and in vivo. Nat. Biotechnol. 20:1006‐1010.
   Yu, J.Y., DeRuiter, S.L., and Turner, D.L. 2002. RNA interference by expression of short‐interfering RNAs and hairpin RNAs in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 99:6047‐6052.
   Zeng, Y., Wagner, E.J., and Cullen, B.R. 2002. Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells. Mol. Cell. 9:1327‐1333.
   Zennou, V., Petit, C., Guetard, D., Nerhbass, U., Montagnier, L., and Charneau, P. 2000. HIV‐1 genome nuclear import is mediated by a central DNA flap. Cell 101:173‐185.
   Zufferey, R., Dull, T., Mandel, R.J., Bukovsky, A., Quiroz, D., Naldini, L., and Trono, D. 1998. Self‐inactivating lentivirus vector for safe and efficient in vivo gene delivery. J. Virol. 72:9873‐9880.
   Zufferey, R., Donello, J.E., Trono, D., and Hope, T.J. 1999. Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors. J. Virol. 73:2886‐2892.
Internet Resources
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library