CRISPR/Cas9‐Mediated Gene Knockout in the Mouse Brain Using In Utero Electroporation

Yohei Shinmyo1, Hiroshi Kawasaki2

1 Department of Medical Neuroscience, Graduate School of Medical Sciences, Kanazawa University, Ishikawa, 2 Brain/Liver Interface Medicine Research Center, Kanazawa University, Ishikawa
Publication Name:  Current Protocols in Neuroscience
Unit Number:  Unit 3.32
DOI:  10.1002/cpns.26
Online Posting Date:  April, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes a highly efficient and rapid procedure for brain‐specific disruption of genes in the developing mouse brain using pX330 plasmids expressing humanized Cas9 and single‐guide RNAs (sgRNAs) against target genes. The pX330 plasmids are delivered into the rodent brain using in utero electroporation. Focusing on the Satb2 gene, which encodes an AT‐rich DNA‐binding transcription factor, we found that the introduction of pX330‐Satb2 induced insertion/deletion (indel) mutations near the predicted cleavage site in the Satb2 gene, resulting in a dramatic reduction of Satb2 expression in post‐mitotic neurons. Moreover, introduction of pX330‐Satb2 induced abnormalities in axonal projection patterns, which was consistent with the phenotypes observed in Satb2 mutant mice. Thus, the procedure described here, combining the CRISPR/Cas9 system and in utero electroporation, is useful for knocking out genes of interest in the living rodent brain. © 2017 by John Wiley & Sons, Inc.

Keywords: CRISPR/Cas9; in utero electroporation; gene knockout; cerebral cortex

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:

  Materials
  • 50 µM sense and anti‐sense oligonucleotides (e.g., Invitrogen)
  • 10× annealing buffer (see recipe)
  • 1 µg/µl pX330 vector (Addgene #42230)
  • BbsI restriction enzyme (e.g., Thermo Fisher Scientific, cat. no. ER1011)
  • 10× restriction enzyme buffer (supplied with BbsI restriction enzyme)
  • 1.2% (w/v) agarose gel with ethidium bromide (see recipe)
  • 10× loading buffer (e.g., Takara, cat. no. 9157)
  • 1× TAE buffer (see recipe)
  • QIAquick Gel Extraction Kit (e.g., Qiagen, cat. no. 28704) containing:
    • QG buffer
    • PE buffer
    • Microcentrifuge column
  • Isopropanol
  • Ligation High Ver.2 (e.g., Toyobo, cat. no. LGK‐201)
  • One Shot TOP10 Chemically Competent E. coli (e.g., Invitrogen, cat. no. C4040‐10)
  • LB plate (see appendix 2A)
  • Ampicillin solution
  • LB liquid medium (see appendix 2A)
  • Primer for analysis: 5′‐TGGACTATCATATGCTTACC‐3′
  • BigDye Terminator v3.1 cycle sequencing kit (e.g., Thermo Fisher Scientific, cat. no. 4337455)
  • QIAGEN EndoFree Plasmid Maxi Kit (e.g., Qiagen, cat. no. 12362)
  • pCAG‐EGFP (Addgene #11150)
  • Fast Green dye
  • Phosphate‐buffered saline (PBS), pH (7.2 e.g., Thermo Fisher Scientific, cat. no. 70013032)
  • Pregnant mouse (E15.5)
  • 10% (w/v) pentobarbital solution
  • 70% (v/v) ethanol
  • 0.9% (w/v) NaCl (saline), prewarmed to 37°C
  • 4% (w/v) paraformaldehyde (PFA) in PBS
  • 1.5‐µl microcentrifuge tubes
  • Variable temperature heating block
  • Variable temperature incubator, with shaking capabilities
  • UV light box
  • Scalpel or razor blade (to cut agarose gel)
  • Microcentrifuge
  • Cell spreader
  • DNA sequencer (e.g., Applied Biosysytems Genetic Analyzer 3500×L)
  • Glass micropipettes
  • Micropipette puller
  • Heating pad
  • Gauze
  • Surgical scissors
  • Fine‐controlled delivery system for glass micropipettes
  • Fiber optic light source
  • Ring forceps
  • Square wave electroporation system (e.g., Harvard Apparatus ECM830)
  • Surgical sutures
  • Fluorescent microscope
  • Additional reagents and equipment for agarose gel electrophoresis ( appendix 1N), DNA sequence analysis (Sanger, Nicklen, & Coulson, ), and transcardial perfusion (unit 1.1; Gerfen, )
NOTE: All protocols involving live animals must first be reviewed and approved by an Institutional Animal Care and Use Committee and must use officially approved procedures for the care and use of laboratory animals.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., & Zhang, F. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819‐823. doi: 10.1126/science.1231143.
  Gerfen, C. R. (2003). Basic Neuroanatomical Methods. Current Protocols in Neuroscience, 00, 1.1.1‐1.1.11. doi: 10.1002/0471142301.ns0101s23.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual‐RNA‐guided DNA endonuclease in adaptive bacterial immunity. Science, 337, 816‐821. doi: 10.1126/science.1225829.
  Kawasaki, H., Iwai, L., & Tanno, K. (2012). Rapid and efficient genetic manipulation of gyrencephalic carnivores using in utero electroporation. Molecular Brain, 5, 24. doi: 10.1186/1756‐6606‐5‐24.
  Kawasaki, H., Toda, T., & Tanno, K. (2013). In vivo genetic manipulation of cortical progenitors in gyrencephalic carnivores using in utero electroporation. Biology Open, 2, 95‐100. doi: 10.1242/bio.20123160.
  Labrie, S. J., Samson, J. E., & Moineau, S. (2010). Bacteriophage resistance mechanisms. Nature Reviews Microbiology, 8, 317‐327. doi: 10.1038/nrmicro2315.
  Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013). RNA‐guided human genome engineering via Cas9. Science, 339, 823‐826. doi: 10.1126/science.1232033.
  Masuda, K., Toda, T., Shinmyo, Y., Ebisu, H., Hoshiba, Y., Wakimoto, M., Ichikawa, Y., & Kawasaki, H. (2015). Pathophysiological analyses of cortical malformation using gyrencephalic mammals. Scientific Reports, 5, 15370. doi: 10.1038/srep15370.
  Saito, T. (2006). In vivo electroporation in the embryonic mouse central nervous system. Nature Protocols, 1, 1552‐1558. doi: 10.1038/nprot.2006.276.
  Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain‐terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America, 74, 5463‐5467.
  Savic, N. & Schwank, G. (2016). Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research, 168, 15‐21. doi: 10.1016/j.trsl.2015.09.008.
  Shinmyo, Y., Tanaka, S., Tsunoda, S., Hosomichi, K., Tajima, A., & Kawasaki, H. (2016). CRISPR/Cas9‐mediated gene knockout in the mouse brain using in utero electroporation. Scientific Reports, 6, 20611. doi: 10.1038/srep20611.
  Toda, T., Shinmyo, Y., Dinh Duong, T. A., Masuda, K., & Kawasaki, H. (2016). An essential role of SVZ progenitors in cortical folding in gyrencephalic mammals. Scientific Reports, 6, 29578. doi: 10.1038/srep29578.
  Tsien, J. Z., Chen, D. F., Gerber, D., Tom, C., Mercer, E. H., Anderson, D. J., Mayford, M., Kandel, E. R., & Tonegawa, S. (1996). Subregion‐ and cell type‐restricted gene knockout in mouse brain. Cell, 87, 1317‐1326. doi: 10.1016/S0092‐8674(00)81826‐7.
  Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F., & Jaenisch, R. (2013). One‐step generation of mice carrying mutations in multiple genes by CRISPR/Cas‐mediated genome engineering. Cell, 153, 910‐918. doi: 10.1016/j.cell.2013.04.025.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library