Profiling of Single‐Cell Transcriptomes

Wanze Chen1, Vincent Gardeux2, Antonio Meireles‐Filho1, Bart Deplancke1

1 Swiss Institute of Bioinformatics, Lausanne, 2 Laboratory of Systems Biology and Genetics, Institute of Bioengineering, School of Life Sciences, Swiss Federal Institute of Technology (EPFL), Lausanne
Publication Name:  Current Protocols in Mouse Biology
Unit Number:   
DOI:  10.1002/cpmo.30
Online Posting Date:  September, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Complex biological systems are composed of multiple cell types whose transcriptional activity can vary due to differences in cell state, environmental stimulation, or intrinsic programs. Conventional bulk analysis methods capture the average transcriptional programs of the cell population, thus missing the unique cellular signature of each single cell. In recent years, the development of single‐cell RNA‐sequencing (scRNA‐seq) technologies has provided a powerful approach to dissect the cellular heterogeneity of complex biological systems. However, such approaches require specialized equipment or are costly. In this article, we describe an improved Smart‐seq2‐based method to profile the transcriptome of hundreds of single cells simultaneously, without utilizing commercial kits or requiring any specialized single‐cell capture/library preparation tools. Moreover, we introduce the Automated Single‐cell Analysis Pipeline (ASAP), which allows researchers without strong computational expertise to explore scRNA‐seq data using a wide range of commonly used algorithms and sophisticated visualization tools. © 2017 by John Wiley & Sons, Inc.

Keywords: single‐cell; transcriptomics; scRNA‐seq; Smart‐seq2; gene expression; Tn5; tagmentation; ASAP; Web tool; analysis pipeline

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Modified SMART‐seq2 Single‐Cell RNA‐seq
  • Support Protocol 1: In‐House Preparation of Tn5 Transposase
  • Alternate Protocol 1: Library Preparation Using the Nextera XT Kit
  • Basic Protocol 2: Data Acquisition, Pre‐Processing, and Functional Analysis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Modified SMART‐seq2 Single‐Cell RNA‐seq

  Materials
  • RNaseZap (Ambion, cat. no. AM9780)
  • Oligos (from IDT, unless noted otherwise): dissolve in nuclease‐free water and store in 100 μM aliquots at −80°C; avoid repeated freeze‐thaw cycles
  • HPLC‐purified oligos:
    • biotin‐oligo‐dT30VN: /5Biosg/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
    • biotin‐ISPCR oligo: /5Biosg/AAGCAGTGGTATCAACGCAGAGT
    • biotin‐TSO: /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG
    • biotin‐TSO‐LNA (from Exiqon): /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrG+G
    • biotin‐TSO: /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG
  • Nuclease‐free water (Invitrogen, cat. no. 10977)
  • ERCC RNA Spike‐In Mix (ThermoFisher, cat. no. 4456740); aliquot and store at −80°C, avoid repeated freeze‐thaw cycles
  • dNTP mix (10 mM each dNTP; Invitrogen, cat. no. 18427013)
  • 0.2% (v/v) Triton X‐100 (see recipe)
  • 40 U/µl recombinant RNase inhibitor (Clontech, cat. no. 2313A)
  • Control RNA (either human or mouse purified RNA, with RNA Integrity Number > 9, diluted to 10 pg/µl before use)
  • Tissues or cells of interest
  • Complete medium (e.g., complete DMEM medium)
  • Cell viability indicator (e.g., Calcein AM) or cell death indicator (e.g., propidium iodide)
  • Magnesium chloride (Sigma‐Aldrich, cat. no. M8266)
  • Betaine (BioUltra ≥99.0%; Sigma‐Aldrich, cat. no. 61962)
  • Maxima H Minus Reverse Transcriptase (200 U/µl; ThermoFisher, cat. no. EP0751)
  • 5× RT buffer (“Maxima H buffer”; ThermoFisher, cat. no. EP0751): 250 mM Tris·Cl (pH 8.3 at 25°C), 375 mM KCl, 15 mM MgCl 2, 50 mM DTT
  • 1 M magnesium chloride (MgCl 2; Sigma‐Aldrich, cat. no. 8266)
  • Betaine (BioUltra, ≥99%; Sigma‐Aldrich, cat. no. 61962)
  • 2× KAPA HiFi HotStart ReadyMix (KAPA Biosystems, cat. no. KK2601)
  • Agencourt Ampure XP beads (Beckman Coulter, cat. no. A 63881)
  • 80% ethanol (analytical reagent grade)
  • 5× TAPS‐DMF buffer ( see recipe)
  • 12.5 µM Tn5 transposase (see protocol 2Support Protocol)
  • 0.2% (w/v) sodium dodecyl sulfate (SDS)
  • KAPA HiFi PCR kit (cat. no. KK2102, note that this kit does not contain hot start activity)
  • Desalted oligos:
    • Ad1.1: AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCG GCAGCGTCAGATGTG
    • Ad1.2: AATGATACGGCGACCACCGAGATCTACACCTCTCTATTCGTCG GCAGCGTCAGATGTG
    • Ad1.3: AATGATACGGCGACCACCGAGATCTACACTATCCTCTTCGTCG GCAGCGTCAGATGTG
    • Ad1.4: AATGATACGGCGACCACCGAGATCTACACAGAGTAGATCGTCG GCAGCGTCAGATGTG
    • Ad1.5: AATGATACGGCGACCACCGAGATCTACACGTAAGGAGTCGTC GGCAGCGTCAGATGTG
    • Ad1.6: AATGATACGGCGACCACCGAGATCTACACACTGCATATCGTCG GCAGCGTCAGATGTG
    • Ad1.7: AATGATACGGCGACCACCGAGATCTACACAAGGAGTATCGTCG GCAGCGTCAGATGTG
    • Ad1.8: AATGATACGGCGACCACCGAGATCTACACCTAAGCCTTCGTCG GCAGCGTCAGATGTG
    • Ad1.9: AATGATACGGCGACCACCGAGATCTACACCGTCTAATTCGTCG GCAGCGTCAGATGTG
    • Ad1.10: AATGATACGGCGACCACCGAGATCTACACTCTCTCCGTCGTC GGCAGCGTCAGATGTG
    • Ad1.11: AATGATACGGCGACCACCGAGATCTACACTCGACTAGTCGTC GGCAGCGTCAGATGTG
    • Ad1.12: AATGATACGGCGACCACCGAGATCTACACTTCTAGCTTCGTC GGCAGCGTCAGATGTG
    • Ad1.13: AATGATACGGCGACCACCGAGATCTACACCCTAGAGTTCGTC GGCAGCGTCAGATGTG
    • Ad1.14: AATGATACGGCGACCACCGAGATCTACACGCGTAAGATCGTC GGCAGCGTCAGATGTG
    • Ad1.15: AATGATACGGCGACCACCGAGATCTACACCTATTAAGTCGTC GGCAGCGTCAGATGTG
    • Ad1.16: AATGATACGGCGACCACCGAGATCTACACAAGGCTATTCGTC GGCAGCGTCAGATGTG
    • Ad1.17: AATGATACGGCGACCACCGAGATCTACACGAGCCTTATCGTC GGCAGCGTCAGATGTG
    • Ad1.18: AATGATACGGCGACCACCGAGATCTACACTTATGCGATCGTC GGCAGCGTCAGATGTG
    • Ad2.1: CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGG CTCGGAGATGT
    • Ad2.2: CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGG CTCGGAGATGT
    • Ad2.3: CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGG CTCGGAGATGT
    • Ad2.4: CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGG CTCGGAGATGT
    • Ad2.5: CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGG CTCGGAGATGT
    • Ad2.6: CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGG CTCGGAGATGT
    • Ad2.7: CAAGCAGAAGACGGCATACGAGATGTAGAGAGGTCTCGTGGG CTCGGAGATGT
    • Ad2.8: CAAGCAGAAGACGGCATACGAGATCCTCTCTGGTCTCGTGGG CTCGGAGATGT
    • Ad2.9: CAAGCAGAAGACGGCATACGAGATAGCGTAGCGTCTCGTGGG CTCGGAGATGT
    • Ad2.10: CAAGCAGAAGACGGCATACGAGATCAGCCTCGGTCTCGTGG GCTCGGAGATGT
    • Ad2.11: CAAGCAGAAGACGGCATACGAGATTGCCTCTTGTCTCGTGG GCTCGGAGATGT
    • Ad2.12: CAAGCAGAAGACGGCATACGAGATTCCTCTACGTCTCGTGG GCTCGGAGATGT
    • Ad2.13: CAAGCAGAAGACGGCATACGAGATATCACGACGTCTCGTGG GCTCGGAGATGT
    • Ad2.14: CAAGCAGAAGACGGCATACGAGATACAGTGGTGTCTCGTGG GCTCGGAGATGT
    • Ad2.15: CAAGCAGAAGACGGCATACGAGATCAGATCCAGTCTCGTGG GCTCGGAGATGT
    • Ad2.16: CAAGCAGAAGACGGCATACGAGATACAAACGGGTCTCGTGG GCTCGGAGATGT
    • Ad2.17: CAAGCAGAAGACGGCATACGAGATACCCAGCAGTCTCGTGG GCTCGGAGATGT
    • Ad2.18: CAAGCAGAAGACGGCATACGAGATAACCCCTCGTCTCGTGG GCTCGGAGATGT
    • Ad2.19: CAAGCAGAAGACGGCATACGAGATCCCAACCTGTCTCGTGG GCTCGGAGATGT
    • Ad2.20: CAAGCAGAAGACGGCATACGAGATCACCACACGTCTCGTGG GCTCGGAGATGT
    • Ad2.21: CAAGCAGAAGACGGCATACGAGATGAAACCCAGTCTCGTGG GCTCGGAGATGT
    • Ad2.22: CAAGCAGAAGACGGCATACGAGATTGTGACCAGTCTCGTGG GCTCGGAGATGT
    • Ad2.23: CAAGCAGAAGACGGCATACGAGATAGGGTCAAGTCTCGTGG GCTCGGAGATGT
    • Ad2.24: CAAGCAGAAGACGGCATACGAGATAGGAGTGGGTCTCGTGG GCTCGGAGATGT
  • Eppendorf™ LoBind PCR Plates (96‐well; Eppendorf, cat. no. 0030129504)
  • Microseal ‘F’ PCR Plate Seal (BioRad, cat. no. MSF1001), or other foil seal
  • Refrigerated centrifuge
  • Multichannel pipettors with aerosol‐filter tips and/or BRAND 8‐channel manifold (Sigma‐Aldrich, cat. no. BR704526‐1EA)
  • 40‐µm cell strainer (Corning, cat. no. 352340)
  • Fluorescence activated cell sorting (FACS) apparatus
  • Microseal ‘B’ PCR Plate Sealing Film (BioRad, cat. no. MSB1001)
  • PCR thermal cycler with heated lid
  • DynaMag™‐96 Side Magnet stand and DynaMag‐2 Magnetic stand (ThermoFisher, cat. no. 12331D and 123.21D)
  • Qubit Fluorometer or similar instrument
  • Fragment analyzer (Advanced Analytical Technologies), 2100 Bioanalyzer (Agilent Technologies), or similar instrument

Support Protocol 1: In‐House Preparation of Tn5 Transposase

  Materials
  • Competent E. coli strain T7 Express lysY/Iq (NEB, cat. no. C3013)
  • pTXB1‐Tn5 construct (order from Addgene: https://www.addgene.org/60240/)
  • Luria‐Bertani (LB) broth medium (see recipe) with and without 100 µg/ml ampicillinLuria‐Bertani (LB) agar plates with 100 µg/ml ampicillin (see recipe)
  • 1 M isopropyl β‐D‐1‐thiogalactopyranoside (IPTG; Sigma, cat. no. I6758)
  • 2× HEGX buffer (see recipe)
  • 50% polyethyleneimine solution (PEI, Sigma, cat. no. P3143)
  • Chitin resin (NEB, cat. no. S6651)
  • Oligonucleotides (desalted): dissolve to 200 μM in 5 mM Tris⋅Cl, pH 8; 5 mM NaCl; 0.25 mM EDTA
    • Tn5MErev: 5′‐[phos]CTGTCTCTTATACACATCT‐3′
    • FC‐121‐1030: 5′‐GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐3′
    • FC‐121‐1031: 5′‐TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐3′
  • Dithiothreitol (DTT)
  • Tn5 dialysis buffer (see recipe)
  • Bovine serum albumin (BSA)
  • BioRad protein assay kit
  • Tn5 storage buffer (see recipe)1 kb+ DNA ladder (Fermentas)
  • Liquid N 2
  • 5× TAPS‐DMF buffer (see recipe)
  • 2× NEBNext High‐Fidelity PCR Master Mix (NEB, cat. no. M0541)
  • Ad1.1 primer (10 µM, from protocol 1)
  • Ad2.1 primer (10 µM, from protocol 1)
  • 100× SYBR Green I (Invitrogen, cat. no. S‐7563)
  • 42°C water bath
  • Shaker incubator
  • 5‐liter Erlenmeyer flasks
  • 500‐ml centrifuge tubes
  • Refrigerated centrifuge with swinging‐bucket rotor
  • Laboratory balance
  • Probe sonicator with 10‐mm tip (e.g., Branson Sonifier)
  • Stainless steel beakers (optional)
  • 15‐ and 50‐ml conical centrifuge tubes with caps (e.g., Corning Falcon)
  • Econo‐Pac® Chromatography Columns (BioRad, cat. no. 7321010)
  • Large beakers
  • Spectra/Por 4 Membrane Dialysis, 12 to 14 kD (Spectrum Labs, cat. no. 132706)
  • PCR tubes
  • Additional reagents and equipment for SDS‐PAGE (Gallagher, ) and Coomassie blue staining of protein gels (Sasse & Gallagher, ), and phenol‐chloroform extraction of DNA (Moore & Dowhan, )

Alternate Protocol 1: Library Preparation Using the Nextera XT Kit

  Additional Materials (also see protocol 1)
  • Nextera XT DNA DNA Library Preparation Kit, 96 samples (Illumina, cat. no. FC‐131‐1096)

Basic Protocol 2: Data Acquisition, Pre‐Processing, and Functional Analysis

  Materials
  • bcl2fastq: Software for trimming/demultiplexing .bcl files (raw sequencing files from the sequencing machine) and creating .fastq files. It can be freely downloaded from the Illumina Web site (https://support.illumina.com/sequencing/sequencing_software/bcl2fastq‐conversion‐software.html). For demultiplexing, bcl2fastq requires a SampleSheet.csv file in the root folder containing the mapping between the barcodes and the sample names. The user can download an example of a SampleSheet.csv file at https://github.com/DeplanckeLab/SmartSeq2.
  • fastQC: Software for QC of .fastq or .bam files. This software assesses the quality of the reads in terms of sequencing quality, duplicate number, adapter contamination, repetitive sequence contamination, and GC content. It can be freely downloaded from its main page (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). The Web site contains informative examples of good‐ (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/good_sequence_short_fastqc.html) and bad‐ (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/bad_sequence_fastqc.html) quality data.
  • STAR: software for read alignments on a reference genome (Dobin et al., ). Can be downloaded from Github (https://github.com/alexdobin/STAR).
  • samtools: software suite for SAM/BAM files (here used for indexing). Can be downloaded from http://samtools.sourceforge.net/.
  • IGV(Integrative Genomics Viewer): a portable Genome Browser–like software (Robinson et al., ). Can be downloaded from http://software.broadinstitute.org/software/igv/.
  • ASAP (Automatic Single‐cell Analysis Pipeline): a Web tool to analyze single‐cell RNA‐seq data (Gardeux, David, Shajkofci, Schwalie, & Deplancke, ). It does not require installation and is readily accessible at http://asap.epfl.ch.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

  Adey, A., Morrison, H. G., Asan, Xun, X., Kitzman, J. O., Turner, E. H., … Shendure, J. (2010). Rapid, low‐input, low‐bias construction of shotgun fragment libraries by high‐density in vitro transposition. Genome Biology, 11, R119. doi: 10.1186/gb‐2010‐11‐12‐r119.
  Ashburner, M., Ball, C. A., Blake, J. A., Botstein, D., Butler, H., Cherry, J. M., … Sherlock, G. (2000). Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nature Genetics, 25, 25–29. doi: 10.1038/75556.
  Brennecke, P., Anders, S., Kim, J. K., Kolodziejczyk, A. A., Zhang, X., Proserpio, V., … Heisler, M. G. (2013). Accounting for technical noise in single‐cell RNA‐seq experiments. Nature Methods, 10, 1093–1095. doi: 10.1038/nmeth.2645.
  Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., & Greenleaf, W. J. (2013). Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA‐binding proteins and nucleosome position. Nature Methods, 10, 1213–1218. doi: 10.1038/nmeth.2688.
  Buettner, F., Natarajan, K. N., Casale, F. P., Proserpio, V., Scialdone, A., Theis, F. J., … Stegle, O. (2015). Computational analysis of cell‐to‐cell heterogeneity in single‐cell RNA‐sequencing data reveals hidden subpopulations of cells. Nature Biotechnology, 33, 155–160. doi: 10.1038/nbt.3102.
  Chen, K. H., Boettiger, A. N., Moffitt, J. R., Wang, S., & Zhuang, X. (2015). RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells. Science, 348, aaa6090. doi: 10.1126/science.aaa6090.
  Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., … Gingeras, T. R. (2013). STAR: Ultrafast universal RNA‐seq aligner. Bioinformatics, 29, 15–21. doi: 10.1093/bioinformatics/bts635.
  Gallagher, S. R. (2012). One‐dimensional SDS gel electrophoresis of proteins. Current Protocols in Molecular Biology, 97, 10.2A.1–10.2A.44. doi: 10.1002/0471142727.mb1002as97.
  Gardeux, V., David, F., Shajkofci, A., Schwalie, P. C., & Deplancke, B. (2017). ASAP: A Web‐based platform for the analysis and inter‐active visualization of single‐cell RNA‐seq data. Bioinformatics, In press. doi: 10.1093/bioinformatics/btx337. [Epub ahead of print].
  Hashimshony, T., Wagner, F., Sher, N., & Yanai, I. (2012). CEL‐Seq: Single‐cell RNA‐Seq by multiplexed linear amplification. Cell Reports, 2, 666–673. doi: 10.1016/j.celrep.2012.08.003.
  Islam, S., Kjallquist, U., Moliner, A., Zajac, P., Fan, J. B., Lonnerberg, P., & Linnarsson, S. (2011). Characterization of the single‐cell transcriptional landscape by highly multiplex RNA‐seq. Genome Research, 21, 1160–1167. doi: 10.1101/gr.110882.110.
  Islam, S., Zeisel, A., Joost, S., La Manno, G., Zajac, P., Kasper, M., … Linnarsson, S. (2014). Quantitative single‐cell RNA‐seq with unique molecular identifiers. Nature Methods, 11, 163–166. doi: 10.1038/nmeth.2772.
  Jaitin, D. A., Kenigsberg, E., Keren‐Shaul, H., Elefant, N., Paul, F., Zaretsky, I., … Amit, I. (2014). Massively parallel single‐cell RNA‐seq for marker‐free decomposition of tissues into cell types. Science, 343, 776–779. doi: 10.1126/science.1247651.
  Kanehisa, M., & Goto, S. (2000). KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Research, 28, 27–30. doi: 10.1093/nar/28.1.27.
  Kharchenko, P. V., Silberstein, L., & Scadden, D. T. (2014). Bayesian approach to single‐cell differential expression analysis. Nature Methods, 11, 740–742. doi: 10.1038/nmeth.2967.
  Kiselev, V. Y., Kirschner, K., Schaub, M. T., Andrews, T., Yiu, A., Chandra, T., … Hemberg, M. (2017). SC3: Consensus clustering of single‐cell RNA‐seq data. Nature Methods, 14(5), 483–486. doi: 10.1038/nmeth.4236.
  Lubeck, E., Coskun, A. F., Zhiyentayev, T., Ahmad, M., & Cai, L. (2014). Single‐cell in situ RNA profiling by sequential hybridization. Nature Methods, 11, 360–361. doi: 10.1038/nmeth.2892.
  Macosko, E. Z., Basu, A., Satija, R., Nemesh, J., Shekhar, K., Goldman, M., … McCarroll, S. A. (2015). Highly parallel genome‐wide expression profiling of individual cells using nanoliter droplets. Cell, 161, 1202–1214. doi: 10.1016/j.cell.2015.05.002.
  Moore, D., & Dowhan, D. (2002). Purification and concentration of DNA from aqueous solutions. Current Protocols in Molecular Biology, 59, 2.1.1–2.1.10. doi: 10.1002/0471142727.mb0201as59.
  Picelli, S., Bjorklund, A. K., Faridani, O. R., Sagasser, S., Winberg, G., & Sandberg, R. (2013). Smart‐seq2 for sensitive full‐length transcriptome profiling in single cells. Nature Methods, 10, 1096–1098. doi: 10.1038/nmeth.2639.
  Picelli, S., Bjorklund, A. K., Reinius, B., Sagasser, S., Winberg, G., & Sandberg, R. (2014). Tn5 transposase and tagmentation procedures for massively scaled sequencing projects. Genome Research, 24, 2033–2040. doi: 10.1101/gr.177881.114.
  Ramskold, D., Luo, S., Wang, Y. C., Li, R., Deng, Q., Faridani, O. R., … Sandberg, R. (2012). Full‐length mRNA‐Seq from single‐cell levels of RNA and individual circulating tumor cells. Nature Biotechnology, 30, 777–782. doi: 10.1038/nbt.2282.
  Ritchie, M. E., Phipson, B., Wu, D., Hu, Y., Law, C. W., Shi, W., & Smyth, G. K. (2015). limma powers differential expression analyses for RNA‐sequencing and microarray studies. Nucleic Acids Research, 43, e47. doi: 10.1093/nar/gkv007.
  Robinson, J. T., Thorvaldsdottir, H., Winckler, W., Guttman, M., Lander, E. S., Getz, G., & Mesirov, J. P. (2011). Integrative genomics viewer. Nature Biotechnology, 29, 24–26. doi: 10.1038/nbt.1754.
  Sasse, J., & Gallagher, S. R. 2009. Staining proteins in gels. Current Protocols in Molecular Biology, 85, 10.6.1–10.6.27. doi: 10.1002/0471142727.mb1006s85.
  Soumillon, M., Cacchiarelli, D., Semrau, S., van Oudenaarden, A., & Mikkelsen, T. S. (2014). Characterization of directed differentiation by high‐throughput single‐cell RNA‐Seq. bioRxiv, available at http://biorxiv.org/content/biorxiv/early/2014/03/05/003236.full.pdf.
  Svensson, V., Natarajan, K. N., Ly, L. H., Miragaia, R. J., Labalette, C., Macaulay, I. C., … Teichmann, S. A. (2017). Power analysis of single‐cell RNA‐sequencing experiments. Nature Methods, 14, 381–387. doi: 10.1038/nmeth.4220.
  Tang, F., Barbacioru, C., Wang, Y., Nordman, E., Lee, C., Xu, N., … Surani, M. A. (2009). mRNA‐Seq whole‐transcriptome analysis of a single cell. Nature Methods, 6, 377–382. doi: 10.1038/nmeth.1315.
  Voytas, D. (2000). Agarose gel electrophoresis. Current Protocols in Molecular Biology, 51, 2.5A.1–2.5A.9. doi: 10.1002/0471142727.mb0205as51.
  Wu, A. R., Neff, N. F., Kalisky, T., Dalerba, P., Treutlein, B., Rothenberg, M. E., … Quake, S. R. (2014). Quantitative assessment of single‐cell RNA‐sequencing methods. Nature Methods, 11, 41–46. doi: 10.1038/nmeth.2694.
  Wu, A. R., Wang, J., Streets, A. M., & Huang, Y. (2017). Single‐cell transcriptional analysis. Annual Review of Analytical Chemistry, 10(1):439–462. doi: 10.1146/annurev‐anchem‐061516‐045228.
  Zhu, Y. Y., Machleder, E. M., Chenchik, A., Li, R., & Siebert, P. D. (2001). Reverse transcriptase template switching: A SMART approach for full‐length cDNA library construction. Biotechniques, 30, 892–897.
  Ziegenhain, C., Vieth, B., Parekh, S., Reinius, B., Guillaumet‐Adkins, A., Smets, M., … Enard, W. (2017). Comparative analysis of single‐cell RNA sequencing methods. Molecular Cell, 65, 631–643 e634. doi: 10.1016/j.molcel.2017.01.023.
Internet Resources
  https://asap.epfl.ch
  ASAP Web site.
  https://github.com/DeplanckeLab/SmartSeq2/
  Github repository for required files.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library