Laboratory Maintenance of Helicobacter Species

Thomas G. Blanchard1, John G. Nedrud2

1 Department of Pediatrics, University of Maryland, Baltimore, Maryland, 2 Department of Pathology, Case Western Reserve University School of Medicine, Cleveland, Ohio
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 8B.1
DOI:  10.1002/9780471729259.mc08b01s24
Online Posting Date:  February, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Helicobacter species are Gram‐negative bacteria that colonize the gastric or intestinal mucosa of many mammalian and avian hosts and induce histologic inflammation. The association of H. pylori with gastritis, peptic ulcer disease, and gastric cancers makes it a significant human pathogen. Animal models for these diseases are being used to explore the pathogenesis of H. pylori infection and in vaccine development. Both bacterial and host factors contribute to Helicobacter pathogenesis; therefore, the microbiology is very important. This unit describes how to culture the most commonly used gastric Helicobacter species, H. pylori, H. mustelae, and H. felis. Curr. Protoc. Microbiol. 24:8B.1.1‐8B.1.19. © 2012 by John Wiley & Sons, Inc.

Keywords: Helicobacter; growth curve; morphological identification; blood agar preparation; pinch biopsy culture methods

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Culture of Helicobacter Organisms on Solid Medium
  • Support Protocol 1: Preparation of Blood Agar Plates for Growth of Helicobacter Species
  • Basic Protocol 2: Culture of Helicobacter pylori in Liquid Medium
  • Alternate Protocol 1: Culture of Helicobacter Species Other than H. pylori in Liquid Medium
  • Support Protocol 2: Quantification of Helicobacter Organisms by Culture
  • Support Protocol 3: Quantification of Helicobacter felis by Culture
  • Support Protocol 4: Quantification of Helicobacter by Quantitative PCR
  • Basic Protocol 3: Culture of Helicobacter Organisms in Agar Stabs
  • Basic Protocol 4: Preparing Clinical Biopsies for Culture of Helicobacter pylori
  • Support Protocol 5: Confirmation of Helicobacter pylori Growth
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Culture of Helicobacter Organisms on Solid Medium

  Materials
  • Freshly prepared blood agar plates containing appropriate antibiotic (see protocol 2)
  • Plates containing viable Helicobacter colonies, liquid culture of Helicobacter ( protocol 3), or frozen stock of Helicobacter
  • Disposable bacterial spreaders (PGC Scientific), laboratory‐made glass spreaders, or inoculating loops
  • Anaerobic jar(s) with sealable lid(s) (BBL model no. 100 uses one microaerophilic system envelope and holds 12 plates; model 150 uses three GasPak envelopes and holds 36 plates); alternatively, BD GasPak EZ Standard (holds 12 or 18 plates) or large (holds 30 to 33 plates) incubation containers or container/microaerophilic systems from other manufacturers can also be used
  • Microaerophilic system envelopes (e.g., BD GasPak EZ Campy paper sachet; Becton Dickinson, cat. no. 260680 or Oxoid CampyGen sachet; Oxoid, cat. no. CN0025 or CN0035, both of which contain activated carbon and ascorbic acid)
NOTE: The abovementioned microaerophilic system envelopes have replaced BBL CampyPak Plus Microaerophilic System Envelopes and Oxoid Gas Generating Kits (Campylobacter System, cat. nos. BR0056 and BR0060) in many countries. The latter systems, which may still be available in some countries, used palladium catalysts and generated carbon dioxide and hydrogen to deplete oxygen, whereas the newer replacement systems do not use catalysts and generate only carbon dioxide.

Support Protocol 1: Preparation of Blood Agar Plates for Growth of Helicobacter Species

  Materials
  • Nutrient agar base: Columbia agar base, Mueller‐Hinton agar base, or blood agar base (available from BBL; also see appendix 2C)
  • Stock solutions of antibiotics (see Table 8.1.1)
  • Defribrinated whole blood (horse, sheep, or ox), sterile (Cleveland Scientific)
  • 1000‐ml Erlenmeyer or round‐bottom glass flasks or 1000‐ml tissue culture bottles
  • 56°C water bath
  • 100‐mm sterile polystyrene petri dishes with sleeves

Basic Protocol 2: Culture of Helicobacter pylori in Liquid Medium

  Materials
  • Brucella broth or other suitable liquid medium supplemented with 10% (v/v) heat‐inactivated FBS
  • Agar plate containing a heavy growth of viable H. pylori ( protocol 1)
  • Disposable bacterial spreaders (PGC Scientific) or laboratory‐made glass spreaders
  • 25‐cm2 polystyrene tissue culture flasks
  • 37°C, 5% CO 2 incubator

Alternate Protocol 1: Culture of Helicobacter Species Other than H. pylori in Liquid Medium

  • Automatic pipetting device (e.g., Drummond Pipet‐Aid or, for volumes ≤1 ml, Gilson pipetman or equivalent automatic pipettor)
  • 5‐ml culture tubes
  • 500‐ml Erlenmeyer or tissue culture bottles that fit inside BBL model no. 100 anaerobic jar
  • Anaerobic jar(s) with sealable lid(s) (BBL model no. 100 or equivalent)
  • Microaerophilic system envelopes (see protocol 1)
  • 37°C rotary shaker with 2‐liter brackets to accommodate a BBL model no. 100 anaerobic jar
  • Additional reagents and equipment for quantification of Helicobacter (see protocol 3; see protocol 8 for H. felis) and examining wet mount of Helicobacter ( protocol 7)

Support Protocol 2: Quantification of Helicobacter Organisms by Culture

  Materials
  • Brucella broth or other suitable liquid medium supplemented with 10% (v/v) heat‐inactivated FBS
  • Actively growing liquid culture of H. pylori (see protocol 3 or protocol 4)
  • Freshly prepared blood agar plates containing appropriate antibiotic (see protocol 2)
  • 25‐cm2 tissue culture flask
  • 37°C, 5% CO 2 incubator
  • Spectrophotometer with visible wavelength spectrum, preferably with adapter for microcuvette
  • Cuvette or microcuvette
  • Sterile tubes for preparing dilutions
  • Disposable bacterial spreaders (PGC Scientific) or laboratory‐made glass spreaders
  • Additional reagents and equipment for microaerophilic plate culture of Helicobacter ( protocol 1)

Support Protocol 3: Quantification of Helicobacter felis by Culture

  Materials
  • Purified chromosomal DNA from H. pylori or H. felis
  • DNA isolation kit (e.g., DNeasy blood and tissue kit; Qiagen)
  • Gastric biopsy tissue (see protocol 9)
  • Primers:
    • H. pyloriureC primers (Forward 5′‐TTATCGGTAAAGACACCAGAAA‐3′; Reverse 5′‐ATCACAGCGCATGTCTTC‐3′)
    • H. felis 16S rRNA primers (Forward 5′‐ATGACATGCCCTTTAGTTTGGGATAGCCA‐3′; Reverse 5′‐CGTTCACCCTCTCAGGCCGGATACC‐3′)
  • SYBR Green mastermix
  • Multiwell PCR assay plates
  • Real‐time thermal cycler

Support Protocol 4: Quantification of Helicobacter by Quantitative PCR

  Materials
  • Active Helicobacter culture growing on Columbia blood agar or acceptable alternative
  • Brucella broth or brain heart infusion medium containing 0.6% agar
  • 5‐ml round‐bottom polypropylene tubes with snap caps (BD Bioscience)
  • Disposable 1‐µl inoculating loops
  • Water pan

Basic Protocol 3: Culture of Helicobacter Organisms in Agar Stabs

  Materials
  • Gastric pinch biopsy material
  • Transport medium (see recipe) in sterile tubes
  • Brucella broth or other suitable liquid medium supplemented with 10% (v/v) FBS
  • Freshly prepared blood agar plates containing appropriate antibiotic (see protocol 2)
  • Sterile forceps
  • Sterile disposable pellet pestles and 1.5‐ml microcentrifuge tubes (Kontes, cat. no. 749520)
  • Disposable bacterial spreaders (PGC Scientific) or laboratory‐made glass spreaders
  • Additional reagents and equipment for microaerophilic plate culture of Helicobacter ( protocol 1)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •   FigureFigure 8.B0.1 Morphology of H. pylori colonies. H. pylori was inoculated onto a blood agar plate 6 days previously. The round translucent colonies illustrate the characteristic appearance of H. pylori grown on plates. The distinct colonies on the right half of the plate resulted from diluting the innoculum used on the left side of the plate 3‐fold. The colonies on the left side are thus more numerous, and also smaller probably as a result of nutrient depletion. With an even more concentrated innoculum, the individual colonies would merge into a confluent translucent mat, best observed by tilting the plate at an angle to the incident light.
  •   FigureFigure 8.B0.2 Agar stab inoculated with H. pylori appearance. H. pylori was inoculated into an agar stab approximately 10 days previously. The two arrows highlight a “cloudy track” along which H. pylori is growing in the agar and from which viable H. pylori can be recovered and passaged onto blood agar plates or a liquid culture.

Literature Cited

   Alm, R.A., Ling, L.S., Moir, D.T., King, B.L., Brown, E.D., Doig, P.C., Smith, D.R., Noonan, B., Guild, B.C., deJonge, B.L., Carmel, G., Tummino, P.J., Caruso, A., Uria‐Nickelsen, M., Mills, D.M., Ives, C., Gibson, R., Merberg, D., Mills, S.D., Jiang, Q., Taylor, D.E., Vovis, G.F., and Trust, T.J. 1991. Genomic‐sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature 397:176‐180.
   Bereswill, S., Schonenberger, R., van Vliet, A.H., Kusters, J.G., and Kist, M. 2005. Novel plasmids for gene expression analysis and for genetic manipulation in the gastric pathogen Helicobacter pylori. FEMS Immunol. Med. Microbiol. 44:157‐162.
   He, Q., Wang, J.P., Osato, M., and Lachman, L.B. 2002. Real‐time quantitative PCR for detection of Helicobacter pylori. J. Clin. Microbiol. 40:3720‐3728.
   Jiang, Q., Hiratsuka, K., and Taylor, D.E. 1996. Variability of gene order in different Helicobacter pylori strains contributes to genome diversity. Mol. Microbiol. 20:833‐842.
   Kawai, M., Furuta, Y., Yahara, K., Tsuru, T., Oshima, K., Handa, N., Takahashi, N., Yoshida, M., Azuma, T., Hattori, M., Uchiyama, I., and Kobayashi, I. 2011. Evolution in an oncogenic bacterial species with extreme genome plasticity: Helicobacter pylori East Asian genomes. B.M.C. Microbiol. 11:104.
   Kleanthous, H., Clayton, C.L., and Tabaqchali, S. 1991. Characterization of a plasmid from Helicobacter pylori encoding a replication protein common to plasmids in Gram‐positive bacteria. Mol. Microbiol. 5:2377‐2389.
   Kong, L., Smith, J.G., Bramhill, D., Abruzzo, G.K., Bonfiglio, C., Cioffe, C., Flattery, A.M., Gill, C.J., Lynch, L., Scott, P.M., Silver, L., Thompson, C., Kropp, H., and Bartizal, K.A. 1996. Sensitive and specific PCR method to detect Helicobacter felis in a conventional mouse model. Clin. Diagn. Lab. Immunol. 3:73‐78.
   Lee, A., O'Rourke, J., De Ungria, M.C., Robertson, B., Daskalopoulos, G., and Dixon, M.F. 1997. A standardized mouse model of Helicobacter pylori infection: Introducing the Sydney strain. Gastroenterology 112:1386‐1397.
   Marshall, B.J. and Warren, J.R. 1984. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet 1:1311‐1315.
   McColm, A.A. 1997. Nonprimate animal models of H. pylori infection. In Helicobacter pylori Protocols (C.L. Clayton and H.L.T. Mobley, eds.) pp. 235‐251. Humana Press, Totowa, N.J.
   McColm, A.A., Bagshaw, J., Wallis, J., and McLaren, A. 1995. Screening of anti‐Helicobacter therapies in mice colonized with H. pylori. Gut 37:A92.
   Reddy, R., Penland, R. L., Osato, M. S., and Graham, D.Y. 2011. Maintaining and shipping Helicobacter pylori on agar stabs. Helicobacter 16:252‐253.
   Stanley, J., Moreno, M.J., Jones, C., and Owen, R.J. 1992. Molecular typing of Helicobacter pylori by chromosomal and plasmid DNA organization. Mol. Cell. Probes 6:305‐312.
   Suerbaum, S. and Michetti, P. 2002. Helicobacter pylori infection. N. Engl. J. Med. 347:1175‐1186.
   Tomb, J.F., White, O., Kerlavage, A.R., Clayton, R.A., Sutton, G.G., Fleischmann, R.D., Ketchum, K.A., Klenk, H.P., Gill, S., Dougherty, B.A., Nelson, K., Quackenbush, J., Zhou, L., Kirkness, E.F., Peterson, S., Loftus, B., Richardson, D., Dodson, R., Khalak, H.G., Glodek, A., McKenney, K., Fitzegerald, L.M., Lee, N., Adams, M.D., Hickey, E.K., Berg, D.E., Gocayne, J.D., Utterback, T.R., Peterson, J.D., Kelley, J.M., Cotton, M.D., Weidman, J.M., Fujii, C., Bowman, C., Watthey, L., Wallin, E., Hayes, W.S., Borodovsky, M., Karp, P.D., Smith, H.O., Fraser, C.M., and Venter, J.C. 1997. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539‐547.
   Tsuda, M., Karita, M., and Nakazawa, T. 1993. Genetic transformation in Helicobacter pylori. Microbiol. Immunol. 37:85‐89.
   Windsor, H.M. and O'Rourke, J. 2000. Bacteriology and taxonomy of Helicobacter pylori. Gastroenterol. Clin. North. Am. 29:633‐648.
   Xu, J., Czinn, S.J., and Blanchard, T.G. 2010. Maintenance of Helicobacter pylori cultures in agar stabs. Helicobacter 15:477‐480.
Key References
   Lee, A. and Megraud, F. (eds.) 1996. Helicobacter pylori: Techniques for Clinical Diagnosis and Basic Research. W. B. Saunders Company, London.
  This monograph contains a collection of clinical, diagnostic and basic research techniques for Helicobacter species.
   Sutton, P. and Mitchell, H. (eds.) 2010. Helicobacter pylori in the 21st Century, Advances in Molecular and Cellular Microbiology Vol. 17. CAB International, Wallingford, United Kingdom.
  This monograph contains a collection of contemporary reviews on the bacteriology, pathogenesis, epidemiology, and host response to H. pylori infections.
Internet Resources
  http://www.helico.com
  Web sites for detailed information about H. pylori history, epidemiology, and pathogenesis.
  http://digestive.niddk.nih.gov/ddiseases/pubs/hpylori/index.aspx
  Biosafety in Microbiology and Biomedical Laboratories, 5th Edition, December 2009. Contains details for handling bacteria of differing safety levels and separate sections for individual pathogens such as H. pylori. PDF versions of the entire monograph, as well as individual sections are available from the U.S. Centers for Disease Control.
   http://www.cdc.gov/biosafety/publications/bmbl5/
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library