Detection, Isolation, and Identification of Vibrio cholerae from the Environment

Anwar Huq1, Bradd J. Haley1, Elisa Taviani1, Arlene Chen1, Nur A. Hasan1, Rita R. Colwell2

1 Maryland Pathogen Research Institute, Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, College Park, Maryland, 2 University of Maryland Institute of Advanced Computer Studies, University of Maryland, College Park, Maryland, and Bloomberg School of Public Health, Johns Hopkins University, Baltimore, Maryland
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 6A.5
DOI:  10.1002/9780471729259.mc06a05s26
Online Posting Date:  August, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Recent molecular advances in microbiology have greatly improved the detection of bacterial pathogens in the environment. These improvements and a downward trend in the cost of molecular detection methods have contributed to increased frequency of detection of pathogenic microorganisms where traditional culture‐based detection methods have failed. Culture methods also have been greatly improved, and the confluence of the two suites of methods provides a powerful tool for detection, isolation, and characterization of pathogens. While molecular detection provides data on the presence and type of pathogens, culturing methods allow a researcher to preserve the organism of interest for “‐omics” studies, such as genomic, metabolomic, secretomic, and transcriptomic analysis, which are rapidly becoming more affordable. This has yielded a clearer understanding of the ecology and epidemiology of microorganisms that cause disease. In this unit, we present commonly accepted methods for isolation, detection, and characterization of V. cholerae, providing more extensive knowledge of the ecology and epidemiology of this organism. This unit has been fully revised and updated from the earlier version with the latest knowledge and additional information not previously included. Curr. Protoc. Microbiol. 26:6A.5.1‐6A.5.51. © 2012 by John Wiley & Sons, Inc.

Keywords: Vibrio cholera; isolation; identification; detection; characterization

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Isolation and Identification of V. cholerae Using Traditional Methods
  • Basic Protocol 1: Specimen Collection and Transportation
  • Basic Protocol 2: Conventional Bacteriological Culture Method
  • Alternate Protocol 1: Bacteriological Culture Method for Situations of Limited Resources
  • Basic Protocol 3: Serogroup Determination
  • Molecular Methods for Detection and Identification of V. cholerae Isolates
  • Support Protocol 1: Preparation of Crude DNA Template by Boiling
  • Basic Protocol 4: Vibrio cholerae–Specific PCR ITS
  • Alternate Protocol 2: Multiplex PCR Assay for Detection of ompW (V. cholerae‐Specific) and ctxA (Toxigenicity)
  • Basic Protocol 5: Multiplex PCR Assay for Detection of O1 AND O139 Serogroup V. cholerae and ctxA
  • Real‐Time PCR for Detection of V. cholerae
  • Basic Protocol 6: TaqMan Assay for Detection of V. cholerae
  • Basic Protocol 7: SYBR Green Assay for Detection of V. cholerae
  • Basic Protocol 8: Direct PCR for Environmental Samples
  • Basic Protocol 9: Colony Blot Hybridization with Labeled RNA or DNA Probes
  • Alternate Protocol 3: Colony Blot Hybridization with Using DIG‐Labeled ctx DNA Probe
  • Support Protocol 2: Digoxigenin Labeling of ctxA Probe Using DIG‐High Prime
  • Immunological Methods for Direct Detection of V. cholerae in Environmental Samples
  • Basic Protocol 10: Fluorescent In Situ Hybridization (FISH) Detection of V. cholerae
  • Basic Protocol 11: Direct Fluorescent Antibody–Direct Viable Count (DFA‐DVC) Method
  • Basic Protocol 12: Indirect Fluorescent Antibody (IFA) Method
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Specimen Collection and Transportation

  Materials
  • Phosphate‐buffered saline (PBS; appendix 2A), sterile
  • Pre‐sterilized 500‐ml glass (Qorpak) and 1000‐ml polypropylene containers (Nalgene)
  • Simple plankton nets, 200‐µm, 64‐µm, and 20‐ µm, or nets of different mesh sizes (for size filtration of plankton); Aquatic Research Instruments (http://www.aquaticresearch.com/) or SEA‐GEAR (http://www.sea‐gear.net/); see Fig. )
  • Portable meter(s) that measure temperature, dissolved oxygen, pH, turbidity, and salinity (HACH Company; Geo Scientific; YSI/Xylem); turbidity and salinity can be measured ex situ, i.e., in the laboratory, preferably immediately after sample collection.
  • Bucket of known volume: .g., 4 or 5 liters (optionally used for pouring water through plankton nets)
  • Piston corer (Aquatic Research Instruments; http://www.aquaticresearch.com/) or a Peterson grab (Wildlife Supply Company; http://www.wildco.com/)
  • Wide‐bore serological pipets
  • Oyster tongs or dredge
  • ≥92‐oz. Whirl‐Pak Bags (eNasco; http://www.enasco.com/)
  • Autoclaved and pre‐weighed 100‐ml polypropylene container (optionally used when collecting sediment from an oyster bed)
  • Scooper/spoon that has been wrapped in aluminum foil and autoclaved (optionally used when collecting sediment from an oyster bed)

Basic Protocol 2: Conventional Bacteriological Culture Method

  Materials
  • Water, plankton, oyster, or sediment samples ( protocol 1)
  • 10× and 1× alkaline peptone water (APW), pH 8.6 (see recipe)
  • Thiosulfate citrate bile‐salts sucrose (TCBS) agar plates (see recipe)
  • Tellurite taurocholate gelatin agar (TTGA) plates (see recipe)
  • CHROMagar Vibrio (CA; http://www.chromagar.com/)
  • Phosphate‐buffered saline (PBS), pH 7.4 ( appendix 2A), sterile
  • 95% alcohol for flame sterilization of forceps, loops, needle, bacterial cell spreader
  • Gelatin agar (GA; see recipe), modified nutrient agar (see recipe), or Luria‐Bertani agar (LB) plates (see appendix 2C)
  • Oxidase reagent: 1% (w/v) N,N,N′N′‐tetramethyl‐p‐phenylenediamine dihydrochloride (e.g., Sigma)
  • Filter membranes, 47‐mm diameter, 0.22‐µm pore size (Millipore)
  • Filter apparatus with vacuum source
  • Forceps
  • 50‐ml centrifuge tubes (e.g., BD Falcon)
  • Inoculating loops, needles, and cell spreaders (see unit 4.1)
  • Tissue homogenizer (hand‐held) to homogenize plankton (Kimble Chase Life Science and Research Products)
  • Enrichment flask (sterile 150‐ml Erlenmeyer flasks)
  • Cut‐resistant oyster shucking glove (Chef Revival, http://www.chefrevival.com/)
  • Oyster knife (Dexter‐Russell; http://www.dexter1818.com/)
  • Autoclavable kitchen blender (Waring, 700G)
  • Filter paper

Alternate Protocol 1: Bacteriological Culture Method for Situations of Limited Resources

  Materials
  • Water sample ( protocol 1)
  • 10× and 1× alkaline peptone water (APW), pH 8.6 (see recipe)
  • Thiosulfate citrate bile‐salts sucrose (TCBS) agar plates (see recipe)
  • Tellurite taurocholate gelatin agar (TTGA) plates (see recipe)
  • CHROMagar Vibrio (CA; http://www.chromagar.com/)
  • Brain‐heart infusion agar stabs (see recipe) containing 0.1% (w/v) esculin and 0.05% (w/v) ferric chloride
  • Luria‐Bertani broth containing 1% (w/v) L‐arginine (pH 6.8) and phenol red powder added as an indicator
  • Sterile mineral oil
  • Inoculating loops and needles, sterile (see unit 4.1)

Basic Protocol 3: Serogroup Determination

  Materials
  • Bacterial growth (6‐ to 16‐hr subculture on nonselective medium; see protocol 2)
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • Antiserum for serogroup O1 and O139 V. cholerae
  • Glass slides
  • Wax pencils

Support Protocol 1: Preparation of Crude DNA Template by Boiling

  Materials
  • 1‐ml overnight culture or loopful of pure culture from agar plate ( protocol 2)
  • 2‐ml microcentrifuge tubes, sterile
  • Boiling water bath

Basic Protocol 4: Vibrio cholerae–Specific PCR ITS

  Materials
  • Crude DNA template ( protocol 5) or extracted genomic DNA ( protocol 11)
  • 10× PCR amplification buffer ( appendix 2A)
  • 25 mM dNTPs ( appendix 2A)
  • 20 µM PCR primers (Table 6.5.3)
  • Taq DNA polymerase
  • Molecular weight ladder (e.g., Hyperladder IV, Bioline)
  • TAE buffer ( appendix 2A)
  • 1 µg/ml ethidium bromide staining solution ( appendix 2A)
  • Thermal cycler (BioRad)
  • Microcentrifuge tubes
  • Boiling water bath
  • PCR tubes
  • Horizontal agarose gel apparatus, gel tray and comb (see Voytas, )
  • Power supply for gel apparatus
  • UV transilluminator (UVP)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

Alternate Protocol 2: Multiplex PCR Assay for Detection of ompW (V. cholerae‐Specific) and ctxA (Toxigenicity)

  Materials
  • Crude DNA template ( protocol 5) or extracted genomic DNA ( protocol 11)
  • 10× PCR amplification buffer ( appendix 2A)
  • 25 mM dNTPs ( appendix 2A)
  • OmpW‐F and R primers
  • ctxA F and R primers
  • Taq DNA polymerase
  • 1.5% agarose gel (Voytas, )
  • Molecular weight ladder (e.g., Hyperladder IV, Bioline)
  • TAE buffer ( appendix 2A)
  • 1 µg/ml ethidium bromide staining solution
  • Thermal cycler
  • PCR tubes
  • UV transilluminator
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

Basic Protocol 5: Multiplex PCR Assay for Detection of O1 AND O139 Serogroup V. cholerae and ctxA

  Materials
  • Crude DNA template ( protocol 5) or extracted genomic DNA ( protocol 11)
  • 10× PCR amplification buffer ( appendix 2A)
  • 20 µM PCR primers (Table 6.5.3)
  • 25 mM dNTPs ( appendix 2A)
  • Taq DNA polymerase
  • Molecular weight ladder (e.g., Hyperladder IV, Bioline)
  • 1 µg/ml ethidium bromide solution
  • Thermal cycler (BioRad)
  • Microcentrifuge tubes
  • Boiling water bath
  • PCR tubes
  • Horizontal gel apparatus, gel tray and comb (see Voytas, )
  • Power supply for gel apparatus
  • UV transilluminator (UVP)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

Basic Protocol 6: TaqMan Assay for Detection of V. cholerae

  Materials
  • 100 ng/µl extracted DNA sample ( protocol 11)
  • TaqMan PCR Reagent Kit (Applied Biosystems) containing:
    • 10× TaqMan buffer A
    • 25 mM MgCl 2
    • dATP, dCTP, dGTP, and dUTPs
    • AmpliTaq Gold DNA polymerase
    • 1 U/µl AmpErase uracil N‐glycosylase (UNG)
  • hylA forward primer (Table 6.5.5)
  • hylA reverse primer (Table 6.5.5)
  • hylA probe (FAM; Table 6.5.5)
  • Optical reaction tubes or plates
  • Optical reaction tube caps or plate seal
  • Real‐time PCR (qPCR) machine

Basic Protocol 7: SYBR Green Assay for Detection of V. cholerae

  Materials
  • Extracted DNA sample ( protocol 11; for optimal results, a serial dilution of various concentrations of DNA samples is suggested)
  • LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics) including:
    • LightCycler FastStart Enzyme
    • LightCycler FastStart Reaction Mix SYBR Green
    • MgCl 2 Stock Solution, 25 mM
    • PCR‐grade Taq DNA polymerase
  • rtxA forward and reverse primer (Table 6.5.5)
  • epsM forward and reverse primer (Table 6.5.5)
  • mshA forward and reverse primer (Table 6.5.5)
  • tcpA forward and reverse primer (Table 6.5.5)
  • Optical reaction tubes or plates
  • Optical reaction tube caps or plate seal
  • Smart Cycler (Cepheid)

Basic Protocol 8: Direct PCR for Environmental Samples

  Materials
  • Water, plankton, sediment, or oyster samples
  • TE buffer ( appendix 2A)
  • 10% (w/v) SDS
  • 20 mg/ml (2% w/v) proteinase K solution
  • 5 M NaCl
  • CTAB/NaCl solution (see recipe)
  • 25:24:1 phenol/chloroform/isoamyl alcohol ( appendix 2A)
  • 24:1 chloroform/isoamyl alcohol
  • Isopropanol
  • 70% ethanol
  • Thermal cycler (BioRad)
  • Microcentrifuge tubes
  • 65°C water bath or heat block
  • Boiling water bath
  • Vacuum desiccator or lyophilizer
  • Additional reagents and equipment for sample collection ( protocol 1), bacteriological culture method for V. cholerae ( protocol 2), and PCR assays (Basic Protocol protocol 64 or protocol 85 or protocol 7)

Basic Protocol 9: Colony Blot Hybridization with Labeled RNA or DNA Probes

  Materials
  • Bacteria growing in APW enrichment flasks ( protocol 2) or water sample for enumeration
  • LB or modified nutrient agar plates (see appendix 2C)
  • 10% (w/v) SDS
  • 3× SSC ( appendix 2A)
  • Pre‐washing solution (see recipe)
  • DEPC‐treated water ( appendix 2A)
  • Hybridization solution base (see recipe)
  • Washing solution (see recipe)
  • Fluorescein‐labeled Vchomim1276 probe, reconstituted at 25 ng/µl (see recipe)
  • 85‐mm sterile nitrocellulose membranes, 0.22‐µm (GE Osmonics)
  • 65°C incubator
  • Filter paper (Whatman)
  • Pyrex dish slightly larger than membrane
  • 70°C oven
  • Typhoon scanner (GE Healthcare) or Dark Reader (Clare Chemical)
NOTE: All solutions should be DNase and RNase‐free. For RNA colony blot hybridization, use DEPC‐treated water (see appendix 2A) to make hybridization solutions.

Alternate Protocol 3: Colony Blot Hybridization with Using DIG‐Labeled ctx DNA Probe

  Materials
  • Bacteria growing in APW enrichment flasks ( protocol 2)
  • Luria‐Bertani (LB) agar plates ( appendix 4A)
  • Cell lysis buffer (see recipe)
  • Blot neutralization solution (see recipe)
  • 1× SSC buffer ( appendix 2A)
  • Proteinase K solution (see recipe)
  • DIG High Prime DNA Labeling and Detection Starter Kit II (Roche) kit includes:
    • DIG Easy Hyb granules
    • 10× blocking solution
    • CSPD
    • Anti‐digoxigenin‐AP conjugate
    • DIG High Prime
  • Labeled ctxA probe ( protocol 14)
  • Stringency wash solution I (see recipe)
  • Stringency wash solution II (see recipe)
  • Maleic acid buffer (see recipe)
  • Antibody solution: 1:10,000 anti‐digoxigenin‐AP conjugate in 1× blocking solution (from kit)
  • Washing buffer (see recipe)
  • Detection buffer (see recipe)
  • Incubators, 37°C and 42°C
  • Sterile nylon (or nitrocellulose) membranes, 85mm, 0.22‐µm (GE Osmonics)
  • Whatman filter paper, #3
  • UV cross‐linker or transilluminator
  • Shaking water bath
  • Hybridization pouch
  • X‐ray film (Kodak or Fuji)
  • Film developer

Support Protocol 2: Digoxigenin Labeling of ctxA Probe Using DIG‐High Prime

  Materials
  • DNA extracted from toxigenic (ctxA+) V. cholerae reference strain (ATCC)
  • Forward and reverse pCTA primers for amplifying ctxA (Table 6.5.5)
  • Plasmid pKTN901 (available from Dr. James Kaper, ) or other source of ctxA probe
  • EcoRI restriction endonuclease (or other restriction enzyme depending on source of ctxA probe) and restriction buffer DIG‐High Prime (Roche)
  • 0.2 M EDTA, pH 8.0
  • Boiling water bath
  • 65°C incubator
  • Additional reagents and equipment for PCR (Kramer and Coen, ), agarose gel electrophoresis (Voytas, ), and isolation and purification of fragments from agarose gels (Moore et al., )

Basic Protocol 10: Fluorescent In Situ Hybridization (FISH) Detection of V. cholerae

  Materials
  • Water for testing
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • 4% formaldehyde (see recipe)
  • PBS‐ethanol solution (1:1 PBS:absolute ethanol)
  • 0.01% (w/v) poly‐L‐lysine (PLL)
  • Ethanol solutions (50%, 80%, and 96%)
  • Hybridization solution (see recipe)
  • FITC‐labeled probe: Vchomim1276, 6‐FAM (fluorescein phosphoramidite) labeled probe (5′‐[5FITC] ACTTTGTGAGATTCGCTCCACCTCG‐3′) at a working concentration of 50 ng/µl in sterile water (final concentration, 5 ng/µl)
  • Washing buffer solution (see recipe)
  • Citifluor AF1 antifade agent (Electron Microscopy Sciences)
  • Multiwell slides
  • Incubator or water bath set to 45°C
  • Humid chamber: 50‐ml centrifuge tube containing one to two strips of hybridization solution–saturated filter paper
  • Whatman filter paper

Basic Protocol 11: Direct Fluorescent Antibody–Direct Viable Count (DFA‐DVC) Method

  Materials
  • Concentrated water or homogenized plankton sample ( protocol 2)
  • Yeast extract, 2.5% solution in distilled water
  • Nalidixic acid, 0.2% solution in distilled water
  • 37% to 40% (v/v) formaldehyde solution or fresh 4% formaldehyde (see recipe)
  • 100% methanol
  • CholeraDFA and/or BengalDFA kit (test kit comes with FITC‐conjugated DFA reagent, positive and negative control, slides and fluorescent mounting medium; New Horizon Diagnostics, http://www.nhdiag.com/)
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • 35°C incubator
  • Multiwell slides and cover slips
  • Humid chamber: 50‐ml centrifuge tube containing one to two strips of filter paper saturated with deionized H 2O
  • Epifluorescent microscope, with FITC filter set
NOTE: All solutions should be 0.1 µm filtered and sterile, as VBNC cells of V. cholerae appear as small coccoid cells in a size range of 0.1 to 0.8 µm.

Basic Protocol 12: Indirect Fluorescent Antibody (IFA) Method

  Materials
  • Concentrated water or homogenized plankton sample ( protocol 2)
  • 95% ethanol
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • FA Rhodamine counterstain (Becton Dickinson)
  • Polyvalent V. cholerae O1 antiserum (BD Difco)
  • FITC‐conjugated anti‐rabbit globulin goat serum (Sigma)
  • Mounting medium, such as FA (Difco) or Citifluor AF1/AF3 (Electron Microscopy Sciences)
  • Multiwell Teflon‐coated slides
  • Incubators, set to 55°C and 35°C
  • Humid chamber: 50‐ml centrifuge tube containing one to two strips of filter paper saturated with deionized H 2O
  • Glass coverslips
  • Epifluorescent microscope with FITC bandwidth filter
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •   FigureFigure 6.A0.1 Flowchart of methods (protocols) used to detect and/or isolate and characterize V. cholerae from the environment.
  •   FigureFigure 6.A0.2 Simple plankton net (Aquatic Research Instruments). The net is composed of a metal ring and bridle, a heavy‐duty nylon net of variable mesh size, and a PVC cod‐end or collecting bucket which can be removed for easy sample collection. A flow meter may be mounted in the mouth of the net to the metal ring to measure volume when the net is towed.
  •   FigureFigure 6.A0.3 Growth of V. cholerae O1 on (A) TCBS, (B) TTGA, (C) CHROMagar Vibrio, courtesy of Dr. Munir Alam, International Center for diarrheal Disease Research, Bangladesh.
  •   FigureFigure 6.A0.4 Results of PCR assays used to detect and characterize V. cholerae. Lane 1, Hyperladder IV (Bioline); lane 2, V. cholerae‐specific ITS; lane 3, ctxA (pCTA); lane 4, tcpA of V. cholerae O1 Classical, lane 5, tcpA of V. cholerae O1 El Tor; lane 6, tcpA of V. cholerae O139; lane 7, toxR; lane 8, zot; lane 9, ompU; lane 10, O1‐O139/ctxA multiplex of V. cholerae O1 and O139.
  •   FigureFigure 6.A0.5 Real‐Time PCR amplification curves of V. cholerae spiked in filter‐sterilized water.
  •   FigureFigure 6.A0.6 Fluorescent in situ hybridization (FISH) image of V. cholerae cells under epifluorescence microscopy.
  •   FigureFigure 6.A0.7 DFA staining of V. cholerae O1 using the CholeraDFA Kit (New Horizon Diagnostics). (A) Fresh culture; (B) VBNC cells; (C) and (D), DVC‐incubated cells.

Videos

Literature Cited

Literature Cited
   Alam, M., Sadique, A., Nur‐, A‐Hasan, Bhuiyan, N.A., Nair, G.B., Siddique, A.K., Sack, D.A., Ahsan, S., Huq, A., Sack, R.B., and Colwell, R.R. 2006a. Effect of transport at ambient temperature on detection and isolation of Vibrio cholerae from environmental samples. Appl. Environ. Microbiol. 72:2185‐2190.
   Alam, M., Hasan, N.A., Sadique, A., Bhuiyan, N.A., Ahmed, K.U., Nusrin, S., Nair, G.B., Siddique, A.K., Sack, R.B., Sack, D.A., Huq, A., and Colwell, R.R. 2006b. Seasonal cholera caused by Vibrio cholerae serogroups O1 and O139 in the coastal aquatic environment of Bangladesh. Appl. Environ. Microbiol. 72:4096‐4104.
   Amann, R.I., Ludwig, W., and Schleifer, K.H. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Mol. Biol. 59:143‐169.
   Bhattacharya, T., Chatterjee, S., Maiti, D., Bhadra, R.K., Takeda, Y., Nair, G.B., and Nandy, R.K. 2006. Molecular analysis of the rstR and orfU genes of the CTX prophages integrated in the small chromosomes of environmental Vibrio cholerae non‐O1, non‐O139 strains. Environ. Microbiol. 8:526‐634.
   Binsztein, N., Costagliola, M.C., Pichel, M., Jurquiza, V., Ramírez, F.C., Akselman, R., Vacchino, M., Huq, A., and Colwell, R. 2004. Viable but nonculturable Vibrio cholerae O1 in the aquatic environment of Argentina. Appl. Environ. Microbiol. 70:7481‐7486.
   Blackstone, G.M., Nordstrom, J.L., Bowen, M.D., Meyer, R.F., Imbro, P., and DePaola, A. 2007. Use of a real time PCR assay for detection of the ctxA gene of Vibrio cholerae in an environmental survey of Mobile Bay. J. Microbiol. Methods 68:254‐259.
   Boyd, E.F. and Waldor, M.K. 2002. Evolutionary and functional analyses of variants of the toxin‐coregulated pilus protein TcpA from toxigenic Vibrio cholerae non‐O1/non‐O139 serogroup isolates. Microbiology 148:1655‐1666.
   Boyle, A. and Perry‐O'Keefe, H. 1992. Labeling and colorimetric detection of nonisotopic probes. Curr. Protoc. Mol. Biol. 20:3.18.1‐3.18.9.
   Brayton, P.R., Roszak, D.B., Palmer, L.M., Huq, S.A., Grimes, D.J., and Colwell, R.R. 1986. Fluorescent antibody enumeration of V. cholerae in the marine environment. IFREMER 3:507‐514.
   Cash, R., Music, S.I., Libonati, J.P., Snyder, M.J., Wenzel, R.P., and Hornick, R.B. 1974. Response of man to infection with Vibrio cholerae I. Clinical, serologic, and bacteriologic responses to a known inoculum. J. Infect. Dis. 129:45‐52.
   Chakraborty, S., Mukhopadhyay, A.K., Bhadra, R.K., Ghosh, A.N., Mitra, R., Shimada, T., Yamasaki, S., Faruque, S.M., Takeda, Y., Colwell, R.R., and Nair, G.B. 2000. Virulence genes in environmental strains of Vibrio cholerae. Appl. Environ. Microbiol. 66:4022‐4028.
   Chatterjee, S., Ghosh, K., Raychoudhuri, A., Chowdhury, G., Bhattacharya, M.K., Mukhopadhyay, A.K., Ramamurthy, T., Bhattacharya, S.K., Klose, K.E., and Nandy, R.K. 2009. Incidence, virulence factors, and clonality among clinical strains of non‐O1, non‐O139 Vibrio cholerae isolates from hospitalized diarrheal patients in Kolkata, India. J. Clin. Microbiol. 47:1087‐1095.
   Choopun, N., Louis, V., Huq, A., and Colwell, R.R. 2002. Simple procedure for rapid identification of Vibrio cholerae from the aquatic environment. Appl. Environ. Microbiol. 68:995‐998.
   Chow, K.H., Ng, T.K., Yuan, K.Y., and Yam, W.C. 2001. Detection of RTX toxin gene in Vibrio cholerae by PCR. J. Clin. Microbiol. 39:2594‐2597.
   Chowdhury, M.A.R., Hasan, J.A.K., Huq, A., Xu, B., and Montilla, R. 1994. DVC‐DFA: A simplified technique for detection of viable Vibrio cholerae O1 and O139. Can. J. Microbiol. 42:87‐93.
   Chun, J., Huq, A., and Colwell, R.R. 1999. Analysis of 16S‐23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus. Appl. Environ. Microbiol. 65:2202‐2208.
   Clesceri, L., Greenberg, A., and Eaton, A. (eds.). 1998. Standard methods for the examination of water and wastewater. American Public Health Association, Washington D.C.
   Colwell, R. 1991. Viable but non‐culturable bacteria in the aquatic environment. Culture 12:1‐4.
   Colwell, R., Tamplin, M. and Brayton, P.R. 1990. Environmental aspects of Vibrio cholerae in transmission of cholera. In Advances in Research on Cholera and Related Diarrhoeas (R. B. Sack and Y. Zinnaka, eds.) pp. 327‐343. K.T.K. Scientific Publishers, Tokyo.
   Constantin de Magny, G., Murtugudde, R., Sapiano, M.R., Nizam, A., Brown, C.W., Busalacchi, A.J., Yunus, M., Nair, G.B., Gil, A.I., Lanata, C.F., Calkins, J., Manna, B., Rajendran, K., Bhattacharya, M.K., Huq, A., Sack, R.B., and Colwell, R.R. 2008. Environmental signatures associated with cholera epidemics. Proc. Natl. Acad. Sci. U.S.A. 105:17676‐17681.
   Dallas, W. and Falkow, S. 1980. Amino acid sequence homology between cholera toxin and Escherichia coli heat‐labile toxin. Nature 288:499‐501.
   Dziejman, M., Serrutom, D., Tam, V.C., Sturtevant, D., Diraphat, P., Faruque, S.M., Rahman, M.H., Heidelberg, J.F., Decker, J., Li, L., Montgomery, K.T., Grills, G., Kucherlapati, R., and Mekalanos, J.J. 2005. Genomic characterization of non‐O1, non‐O139 Vibrio cholerae reveals genes for a type III secretion system. Proc. Natl. Acad. Sci. U.S.A. 102:3465‐3470.
   Faruque, S.M., Chowdhury, N., Kamruzzaman, M., Ahmad, Q.S., Faruque, A.S.G., Abdus Salam, M., Ramamurthy, T., Nair, G.B., Weintraub, A., and Sack, D. 2003. Reemergence of epidemic Vibrio cholerae O139, Bangladesh. Emerg. Infect. Dis. 9:1116‐1122.
   Fasano, A., Baudry, B., and Pumplin, D.W. 1991. Vibrio cholerae produces a second enterotoxin which affects intestinal tight junctions. Proc. Natl. Acad. Sci. U.S.A. 88:5242‐5246.
   Fields, P.I., Popovic, T., Wachsmuth, K., and Olsvik, Ø. 1992. Use of polymerase chain reaction for detection of toxigenic Vibrio cholerae O1 strains from the Latin American cholera epidemic. J. Clin. Microbiol. 30:2118‐2121.
   Grim, C.J., Choi, J., Chun, J., Jeon, Y.S., Taviani, E., Hasan, N.A., Haley, B., Huq, A., and Colwell, R.R. 2010. Occurrence of the Vibrio cholerae seventh pandemic VSPI island and a new variant. OMICS 14:1‐7.
   Gubala, A.J. 2006. Multiplex real‐time PCR detection of Vibrio cholerae. J. Microbiol. Methods 65:278‐293.
   Gubala, A. and Proll, D. 2006. Molecular‐beacon multiplex real‐time PCR assay for detection of Vibrio cholerae. Appl. Environ. Micbrobiol. 72:6424‐6428.
   Haley, B.J., Chen, A., Grim, C.J., Clark, P., Diaz, C.M., Taviani, E., Hasan, N.A., Sancomb, E., Elnemr, W.M., Islam, M.A., Huq, A., Colwell, R.R., and Benediktsdóttir, E. 2012. Vibrio cholerae in an historically cholera‐free country. Environ. Microbiol. Rep. doi:10.1111/j.1758‐2229.2012.00332.x.
   Hasan, J., Loomis, L. Huq, A., Bernstein, D., Tamplin, M.L., and Wier, M. 1992. Development of a fast, simple, and sensitive immunoassay to detect Vibrio cholerae O1 from clinical samples using SMART™ Kit. 92nd Genl. Mtg Am. Soc. Microbiol., New Orleans, Louisiana.
   Hasan, J.A.K., Bernstein, D., Huq, A., Loomis, L., Tamplin, M.L., and Colwell, R.R. 1994. Cholera DFA: An improved direct fluorescent monoclonal antibody staining kit for rapid detection and enumeration of V. cholerae O1. FEMS Microbiol. Lett. 120:143‐148.
   Hasan, J., Huq, A., Nair, G.B., Garg, S., Mukhopadhyay, A.K., Loomis, L., Bernstein, D., and Colwell, R.R. 1995. Development and testing of monoclonal antibody‐based rapid immunodiagnostic test kits for direct detection of Vibrio cholerae O139 synonym Bengal. J. Clin. Microbiol. 33:2935‐2939.
   Heidelberg, J. 1997. Seasonal abundance of bacterioplankton populations of bacteria, gamma proteobacteria, Vibrio/Photobacterium, Vibrio vulnificus, Vibrio cholerae/Vibrio mimicus, and Vibrio cincinnatiensis associated with zooplankton in the Choptank River, Maryland. Ph.D. thesis. University of Maryland, College Park, Maryland.
   Heidelberg, J., Heidelberg, K., and Colwell, R.R. 2002. Seasonality of Chesapeake Bay bacterioplankton species. Appl. Environ. Microbiol. 68:5488‐5497.
   Hoshino, K., Yamasaki, S., Mukhopadhyay, A.K., Chakraborty, S., Basu, A., Bhattacharya, S.K., Nair, G.B., Shimada, T., and Takeda, Y. 1998. Development and evaluation of a multitest PCR assay for rapid detection of toxigenic Vibrio cholerae O1 and O139. FEMS Immunol. Med. Microbiol. 20:201‐207.
   Huq, A., Small, E.B., West, P.A., and Colwell, R.R. 1984. The role of planktonic copepods in the survival and multiplication of Vibrio cholerae in the aquatic environment. In Vibrios in the Environment (R.R. Colwell, ed.) pp. 521‐534. John Wiley & Sons, New York
   Huq, A., Colwell, R.R., Rahman, R., Ali, A., Chowdhury, M.A., Parveen, S., Sack, D.A., and Russek‐Cohen, E. 1990. Detection of Vibrio cholerae O1 in the aquatic environment by fluorescent monoclonal antibody and culture methods. Appl. Environ. Microbiol. 56:2370‐2373.
   Huq, A., Sack, R.B., Nizam, A., Longini, I.M., Nair, G.B., Ali, A., Morris, J.G. Jr., Khan, M.N., Siddique, A.K., Yunus, M., Albert, M.J., Sack, D.A., and Colwell, R.R. 2005. Critical factors influencing the occurrence of Vibrio cholerae in the environment of Bangladesh. Appl. Environ. Microbiol. 718:4645‐4654.
   Huq, A., Grim, C., Colwell, R.R., and Nair, G.B. 2006. Detection, isolation, and identification of Vibrio cholerae from the environment. Curr. Protoc. Microbiol. 2:6A.5.1‐6A.5.38.
   Islam, M., Rahman, M.Z., Khan, S.I., Mahmud, Z.H., Ramamurthy, T., Nair, G.B., Sack, R.B., and Sack, D.A. 2005. Organization of the CTX prophage in environmental isolates of Vibrio mimicus. Microbiol. Immunol. 49:779‐784.
   Kaper, J., Morris, J., and Nishibuchi, M. 1988. DNA probes for pathogenic Vibrio species. In DNA Probes for Infectious Diseases (F. Tenover, ed.) pp. 65‐77. CRC Press, Boca Raton, Fla.
   Keasler, S.P. and Hall, R.H. 1993. Detecting and biotyping Vibrio cholerae O1 with multiplex polymerase chain reaction. Lancet 341:1661.
   Kenyon, J.E., Piexoto, D.R., Austin, B., and Gillies, D.C. 1984. Seasonal variations of Vibrio cholerae (non‐O1) isolated from California coastal waters. Appl. Environ. Microbiol. 47:1243‐1245.
   Kogure, K., Simidu, U., and Taga, N. 1979. A tentative direct microscopic method for counting living marine bacteria. Can. J. Microbiol. 25:415‐420.
   Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
   Lin, W., Fullner, K.J., Clayton, R., Sexton, J.A., Rogers, M.B., Calia, K.E., Calderwood, S.B., Fraser, C., and Mekalanos, J.J. 1999. Identification of a Vibrio cholerae RTX toxin gene cluster that is tightly linked to the cholera toxin prophage. Proc. Natl. Acad. Sci. U.S.A. 96:1071‐1076.
   Lizarraga‐Partida, M.L., Wong‐Chang, I., et al. Vibrio cholerae O1 and non‐O1 in two coastal lagoons of Veracruz. Manuscript in preparation.
   Louis, V., Russek‐Cohen, E., Choopun, N., Rivera, I.N., Gangle, B., Jiang, S.C., Rubin, A., Patz, J.A., Huq, A., and Colwell, R.R. 2003. Predictability of Vibrio cholerae in Chesapeake Bay. Appl. Environ. Microbiol. 69:2773‐2785.
   Lyon, W.J. 2001. TaqMan PCR for detection of Vibrio cholerae O1, O139, non‐O1, and non‐O139 in pure cultures, raw oysters, and synthetic seawater. Appl. Environ. Microbiol. 67:4685‐4693.
   Malayil, L., Turner, J.W., et al. 2010. Novel reservoirs of the CTX gene. In Vibrios in the Environment. Conference Proceedings, Biloxi, Miss.
   Monsur, K. 1961. A highly selective gelatin‐taurocholate‐tellurite medium for the isolation of Vibrio cholerae. Trans. R. Soc. Trop. Med. Hyg. 55:440‐442.
   Moore, D., Dowhan, D., Chory, J., and Ribaudo, R.K. 2002. Isolation and purification of large DNA restriction fragments from agarose gels. Curr. Protoc. Mol. Biol. 59:2.6.1‐2.6.12.
   Morris, G., Merson, M.H., Huq, I., Kibrya, A.K., and Black, R. 1979. Comparison of four plating media for isolating Vibrio cholerae. J. Clin. Microbiol. 9:79‐83.
   Murray, M. and Thompson, W. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8:4321‐4325.
   Nandi, B., Nandy, R.K., Mukhopadhyay, S., Nair, G.B., Shimada, T., and Ghose, A.C. 2000. Rapid method for species‐specific identification of Vibrio cholerae using primers targeted to the gene of outer membrane protein OmpW. J. Clin. Microbiol. 38:4145‐4151.
   Nusrin, S., Khan, G.Y., Bhuiyan, N.A., Ansaruzzaman, M., Hossain, M.A., Safa, A., Khan, R., Faruque, S.M., Sack, D.A., Hamabata, T., Takeda, Y., and Nair, G.B. 2004. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic in Bangladesh. J. Clin. Microbiol. 42:5854‐5856.
   O'Brien, M. and Colwell, R.R. 1985. Modified taurochalate‐tellurite‐gelatin agar for improved differentiation of Vibrio species. J. Clin. Microbiol. 22:1011‐1013.
   Ogawa, A., Kato, J., Watanabe, H., Nair, B.G., and Takeda, T. 1990. Cloning and nucleotide sequence of a heat‐stable enterotoxin gene from Vibrio cholerae non‐O1 isolated from a patient with traveler's diarrhea. Infect. Immun. 58:3325‐3329.
   Onifade, T.J., Hutchinson, R., Van Zile, K., Bodager, D., Baker, R., and Blackmore, C. 2011. Toxin producing Vibrio cholerae O75 outbreak, United States, March to April 2011. Euro. Surveill. 16:19870.
   O'Shea, Y.A. and Boyd, E.F. 2002. Mobilization of the Vibrio pathogenicity island between Vibrio cholerae isolates mediated by CP‐T1 generalized transduction. FEMS Microbiol. Lett. 214:153‐157.
   O'Shea, Y., Reen, F.J., Quirke, A.M., and Boyd, E.F. 2004. Evolutionary genetic analysis of the emergence of epidemic Vibrio cholerae isolates on the basis of comparative nucleotide sequence analysis and multilocus virulence gene profiles. J Clin. Microbiol. 42:4657‐4671.
   Pal, A., Ramamurthy, T., Bhadra, R.K., Takeda, T., Shimada, T., Takeda, Y., Nair, G.B., Pal, S.C., and Chakrabarti, S. 1992. Reassessment of the prevalence of heat‐stable enterotoxin (NAG‐ST) among environmental Vibrio cholerae non‐O1 strains isolated from Calcutta, India, by using a NAG‐ST DNA probe. Appl. Environ. Microbiol. 58:2485‐2489.
   Ramamurthy, T., Albert, M.J., Huq, A., Colwell, R.R, Takeda, Y., Takeda, T., Shimada, T., Mandal, B.K., and Nair, G.B. 1994. Vibrio mimicus with multiple toxin types isolated from human and environmental sources. J Med Microbiol. 40:194‐196.
   Rawlings, T.K., Ruiz, G.M., and Colwell, R.R. 2007. Association of Vibrio cholerae O1 El Tor and O139 Bengal with the copepods Acartia tonsa and Eurytemora affinis. Appl. Environ. Microbiol. 73:7926‐7933.
   Rehnstam, A.‐S., Norqvist, A., Wolf‐Watz, H., and Hagström, A. 1989. Identification of Vibrio anguillarum in fish by using partial 16S rRNA sequences and a specific 16S rRNA oligonucleotide probe. Appl. Environ. Microbiol. 55:1907‐1910.
   Rennels, M., Levine, M.M., Daya, V., Angle, P., and Young, C. 1980. Selective vs. nonselective media and direct plating vs. enrichment technique in isolation of Vibrio cholerae: Recommendations for clinical laboratories. J. Infect. Dis. 142:328‐331.
   Rivera, I., Chun, J., Huq, A., Sack, R., and Colwell, R.R. 2001. Genotypes associated with virulence in environmental isolates of Vibrio cholerae. J. Appl. Environ. Microbiol. 67:2421‐2429.
   Roszak, D. and Colwell, R. 1987. Survival strategies of bacteria in the natural environment. Microbiol. Rev. 51:365‐379.
   Rubin, E.J., Lin, W., Mekalanos, J.J., and Waldor, M.K. 1998. Replication and integration of a Vibrio cholerae cryptic plasmid linked to the CTX prophage. Mol. Microbiol. 28:1247‐1254.
   Sack, R., Siddique, A.K., Longini, I.M. Jr., Nizam, A., Yunus, M., Islam, M.S., Morris, J.G. Jr., Ali, A., Huq, A., Nair, G.B., Qadri, F., Faruque, S.M., Sack, D.A., and Colwell, R.R. 2003. A 4‐year study of the epidemiology of Vibrio cholerae in four rural areas of Bangladesh. J. Infect. Dis. 187:96‐101.
   Schuster, B.M., Tyzik, A.L., Donner, R.A., Striplin, M.J., Almagro‐Moreno, S., Jones, S.H., Cooper, V.S., and Whistler, C.A. 2011. Ecology and genetic structure of a northern temperate Vibrio cholerae population related to toxigenic isolates. Appl. Environ. Microbiol. 77:7568‐7575.
   Shirai, U.N., Nishibuchi, M., and Ramamurthy, T. 1991. Polymerase chain reaction for detection of the cholera toxin operon of Vibrio cholerae. J. Clin. Microbiol. 29:2517‐2521.
   Spira, W., Huq, A., Ahmed, Q.S., and Saeed, Y.A. 1981. Uptake of Vibrio cholerae biotype eltor from contaminated water by water hyacinth (Eichornia crassipes). Appl. Environ. Microbiol. 42:550‐553.
   Taviani, E., Grim, C.J., Choi, J., Chun, J. Haley, B., Hasan, N.A., Huq, A., and Colwell, R.R. 2010. Discovery of novel Vibrio cholerae VSP II genomic islands using comparative genomic analysis. FEMS Microbiol. Lett. 308:130‐137.
   Trucksis, M., Galen, J.E., Michalski, J., Fasano, A., and Kaper, J.B. 1993. Accessory cholera toxin (Ace), the third toxin of a Vibrio cholerae virulence cassette. Proc. Natl. Acad. Sci. U.S.A. 90:5267‐5271.
   Turner, J.W., Good, B., Cole, D., and Lipp, E.K. 2009. Plankton composition and environmental factors contribute to Vibrio seasonality. ISME J. 3:1082‐1092.
   Vora, G.J., Meador, C.E., Bird, M.M., Bopp, C.A., Andreadis, J.D., and Stenger, D.A. 2005. Microarray‐based detection of genetic heterogeneity, antimicrobial resistance, and the viable but nonculturable state in human pathogenic Vibrio spp. Proc. Natl. Acad. Sci. U.S.A. 102:19109‐19114.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
   Waldor, M.K., Rubin, E.J., Pearson, G.D., Kimsey, H., and Mekalanos, J.J. 1997. Regulation, replication, and integration functions of the Vibrio cholerae CTXphi are encoded by region RS2. Mol. Microbiol. 24:917‐926.
   White, P. 1940. The characteristic hapten and antigen of rugose races of cholera and El Tor vibrios. J. Pathol. Bacteriol. 50:160‐164.
   Xu, H.S., Roberts, N.C., Singleton, F.L., Attwell, R.W., Grimes, D.J., and Colwell, R.R. 1982. Survival and viability of nonculturable Escherichia coli and Vibrio cholerae in the estuarine and marine environment. Microbiol. Ecol. 8:313‐323.
   Xu, H.S., Roberts, N.C., Adams, L.B., West, P.A., Siebeling, R.J., Huq, A., Huq, M.I., Rahmand, R., and Colwell, R.R. 1984. An indirect fluorescent antibody staining procedure for detection of Vibrio cholerae serovar O1 cells in aquatic environmental samples. J. Microb. Methods 2:221‐231.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Supplementary Material