CASAAV: A CRISPR‐Based Platform for Rapid Dissection of Gene Function In Vivo

Nathan J. VanDusen1, Yuxuan Guo1, Weiliang Gu2, William T. Pu3

1 Department of Cardiology, Boston Children's Hospital, Boston, Massachusetts, 2 Department of Pharmacology, School of Pharmacy, Shanghai University of Traditional Chinese Medicine, Shanghai, 3 Harvard Stem Cell Institute, Harvard University, Cambridge, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 31.11
DOI:  10.1002/cpmb.46
Online Posting Date:  October, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

In vivo loss‐of‐function studies are currently limited by the need for appropriate conditional knockout alleles. CRISPR/Cas9 is a powerful tool commonly used to induce loss‐of‐function mutations in vitro. However, CRISPR components have been difficult to deploy in vivo. To address this problem, we developed the CASAAV (CRISPR/Cas9/AAV‐based somatic mutagenesis) platform, in which recombinant adeno‐associated virus (AAV) is used to deliver tandem guide RNAs and Cre recombinase to Cre‐dependent Cas9‐P2A‐GFP mice. Because Cre is under the control of a tissue‐specific promoter, this system allows temporally controlled, cell type‐selective knockout of virtually any gene to be obtained within a month using only one mouse line. Here, we focus on gene disruption in cardiomyocytes, but the system could easily be adapted to inactivate genes in other cell types transduced by AAV. © 2017 by John Wiley & Sons, Inc.

Keywords: CRISPR; Adeno‐associated virus; Mouse model; Genetic mosaic; Cardiomyocyte

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Target and gRNA Selection
  • Basic Protocol 2: Construction and Delivery of AAV9 Vector
  • Basic Protocol 3: Immunostaining Isolated Cardiomyocytes
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Target and gRNA Selection

  Materials
  • Computer with internet connection

Basic Protocol 2: Construction and Delivery of AAV9 Vector

  Materials
  • gRNA oligonucleotides (from protocol 1)
  • Annealing buffer (10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA)
  • AAV‐U6gRNA1‐U6gRNA2‐TnT‐Cre vector (Addgene, cat. no. 87682)
  • AarI enzyme and buffer (Thermo Fisher, cat. no. ER1581)
  • SapI enzyme and buffer (NEB, cat. no. R0569L)
  • 6× DNA loading dye (NEB, cat. no. B7024S)
  • Agarose (GeneMate, cat. no. E‐3120‐500)
  • 50× TAE (Boston BioProducts, cat. no. BM250)
  • Ethidium bromide (Sigma‐Aldrich, cat. no. E7637)
  • Gel purification kit (Thermo Fisher Scientific, cat. no. K210012)
  • Chemically competent cells, e.g., MAX Efficiency Stbl2 Competent Cells (ThermoFisher, cat. no. 10268019).Recombination‐resistant bacteria are essential.
  • Quick ligation kit (NEB, cat. no. M2200L)
  • Ampicillin (Thermo Fisher, cat. no. 11593027)
  • LB agar plates with 100 µg/ml Ampicillin (Teknova, cat. no. L1004)
  • LB media (40 g/liter H 2O, Teknova, cat. no. L9115)
  • Miniprep kit (Thermo Fisher Scientific, cat. no. K210011)
  • TnT‐R sequencing primer, AGGGACTTCGGGCACAATCG
  • Midiprep kit (Thermo Fisher Scientific, cat. no. K210014)
  • Isoflurane (Baxter, cat. no. 10019‐360‐40)
  • PCR tubes
  • Thermal cycler
  • 37°C incubator
  • 37°C shaking incubator
  • Gel electrophoresis chamber
  • UV transilluminator (365 nm)
  • 42°C heat block or waterbath
  • Miniprep culture tubes (Corning, cat. no. 352059)
  • Nanodrop spectrophotometer (Thermo Fisher Scientific, cat. no. ND‐1000)
  • Isoflurane anesthesia setup (anesthesia machine, induction chamber, scavenging system).
  • 0.3‐ml syringes (XELINT, cat. no. 26200)
  • Rosa26Cas9‐GFP mice (Jackson Laboratory, cat. no. 026175)
  • Additional reagents and equipment for AAV production and purification (unit 23.16; Wakimoto, et al., ).

Basic Protocol 3: Immunostaining Isolated Cardiomyocytes

  Materials
  • 1 mg/ml laminin (Corning, cat. no. 354239) in PBS
  • PBS (Thermo Fisher Scientific, cat. no. 10010‐023)
  • AAV‐treated Rosa26Cas9‐GFP mice (from protocol 2)
  • Blebbistatin (EMD Millipore, cat. no. 203390)
  • Dulbecco's modified Eagle's medium (DMEM), high glucose (Gibco, cat. no. 11995‐065)
  • 4% paraformaldehyde (PFA; Electron Microscopy Sciences, cat. no. 15710), diluted in PBS
  • PBST: PBS containing 0.1% Triton X‐100 (Sigma‐Aldrich, cat. no. T9284)
  • Block solution: PBS containing 4% BSA (Sigma‐Aldrich, cat. no. A3912‐1006)
  • Prolong Diamond Antifade Mountant (Thermo Fisher Scientific, cat. no. P36961)
  • Primary antibody
  • Secondary antibody
  • Round coverslips (Fisher Scientific, cat. no. 50‐121‐5159)
  • 24‐well dishes (Corning, cat. no. 3526)
  • Coverglass forceps (Fine Science Tools, cat. no. 11074‐02)
  • 27‐gauge needle (BD Biosciences, cat. no. 305136)
  • 37°C, humidified CO 2 incubator
  • Langendorf perfusion apparatus and materials for collagenase perfusion (O'Connell et al., ).
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Bae, S., Kweon, J., Kim, H. S., & Kim, J.‐S. (2014). Microhomology‐based choice of Cas9 nuclease target sites. Nature Methods, 11, 705–706. doi: 10.1038/nmeth.3015.
  Canver, M. C., Bauer, D. E., Dass, A., Yien, Y. Y., Chung, J., Masuda, T., … Orkin, S. H. (2014). Characterization of genomic deletion efficiency mediated by clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells. Journal of Biological Chemistry, 289, 21312–21324. doi: 10.1074/jbc.M114.564625.
  Carroll, K. J., Makarewich, C. A., McAnally, J., Anderson, D. M., Zentilin, L., Liu, N., … Olson, E. N. (2016). A mouse model for adult cardiac‐specific gene deletion with CRISPR/Cas9. Proceedings of the National Academy of Sciences of the United States of America, 113, 338–343. doi: 10.1073/pnas.1523918113.
  Das, G., Henning, D., Wright, D., & Reddy, R. (1988). Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III. EMBO Journal, 7, 503–512.
  Doench, J. G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E. W., Donovan, K. F., … Root, D. E. (2016). Optimized sgRNA design to maximize activity and minimize off‐target effects of CRISPR‐Cas9. Nature Biotechnology, 34, 184–191. doi: 10.1038/nbt.3437.
  Ellington, A. and Pollard, J. D. 2001. Synthesis and purification of oligonucleotides. Current Protocols in Molecular Biology, 42, 2.11.1–2.11.25.
  Guo, Y., VanDusen, N. J., Zhang, L., Gu, W., Sethi, I., Guatimosim, S., … Pu, W. T. (2017). Analysis of cardiac myocyte maturation using CASAAV, a platform for rapid dissection of cardiac myocyte gene function in vivo. Circulation Research, 120, 18741888. doi: 10.1161/CIRCRESAHA.116.310283.
  O'Connell, T. D., Rodrigo, M. C., & Simpson, P. C. (2005). Isolation and culture of adult mouse cardiac myocytes. In F. Vivanco (Ed.), Cardiovascular proteomics (pp. 271–296). Methods in Molecular Biology, vol. 357. Humana Press.
  Paule, M. R. (2000). SURVEY AND SUMMARY: Transcription by RNA polymerases I and III. Nucleic Acids Research, 28, 1283–1298. doi: 10.1093/nar/28.6.1283.
  Platt, R. J., Chen, S., Zhou, Y., Yim, M. J., Swiech, L., Kempton, H. R., … Zhang, F. (2014). CRISPR‐Cas9 knockin mice for genome editing and cancer modeling. Cell, 159, 440–455. doi: 10.1016/j.cell.2014.09.014.
  Prasad, K. M. R., Xu, Y., Yang, Z., Acton, S. T., & French, B. A. (2011). Robust cardiomyocyte‐specific gene expression following systemic injection of AAV: In vivo gene delivery follows a Poisson distribution. Gene Therapy, 18, 43–52. doi: 10.1038/gt.2010.105.
  Prendiville, T. W., Guo, H., Lin, Z., Zhou, P., Stevens, S. M., He, A., … Pu, W. T. (2015). Novel roles of GATA4/6 in the postnatal heart identified through temporally controlled, cardiomyocyte‐specific gene inactivation by adeno‐associated virus delivery of Cre recombinase. PLoS One, 10, e0128105. doi: 10.1371/journal.pone.0128105.
  Swiech, L., Heidenreich, M., Banerjee, A., Habib, N., Li, Y., Trombetta, J., … Zhang, F. (2015). In vivo interrogation of gene function in the mammalian brain using CRISPR‐Cas9. Nature Biotechnology, 33, 102–106. doi: 10.1038/nbt.3055.
  Wakimoto, H., Seidman, J. G., Foo, R. S. Y., & Jiang, J. (2016). AAV9 Delivery of shRNA to the Mouse Heart. Current Protocols in Molecular Biology, 115, 23.16.21–23.26.29. doi: 10.1002/cpmb.9.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library