A Detailed Protocol for Subcellular RNA Sequencing (subRNA‐seq)

Andreas Mayer1, L. Stirling Churchman2

1 Max Planck Institute for Molecular Genetics, Berlin, 2 Department of Genetics, Harvard Medical School, Boston
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 4.29
DOI:  10.1002/cpmb.44
Online Posting Date:  October, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

In eukaryotic cells, RNAs at various maturation and processing levels are distributed across cellular compartments. The standard approach to determine transcript abundance and identity in vivo is RNA sequencing (RNA‐seq). RNA‐seq relies on RNA isolation from whole‐cell lysates and thus mainly captures fully processed, stable, and more abundant cytoplasmic RNAs over nascent, unstable, and nuclear RNAs. Here, we provide a step‐by‐step protocol for subcellular RNA‐seq (subRNA‐seq). subRNA‐seq allows the quantitative measurement of RNA polymerase II–generated RNAs from the chromatin, nucleoplasm, and cytoplasm of mammalian cells. This approach relies on cell fractionation prior to RNA isolation and sequencing library preparation. High‐throughput sequencing of the subcellular RNAs can then be used to reveal the identity, abundance, and subcellular distribution of transcripts, thus providing insights into RNA processing and maturation. Deep sequencing of the chromatin‐associated RNAs further offers the opportunity to study nascent RNAs. Subcellular RNA‐seq libraries are obtained within 5 days. © 2017 by John Wiley & Sons, Inc.

Keywords: Cell fractionation; subcellular RNA‐seq; nascent RNA; RNA polymerase II (Pol II); transcription; next‐generation sequencing; RNA processing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Cell Fractionation and RNA Isolation
  • Basic Protocol 2: Sequencing Library Preparation
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Cell Fractionation and RNA Isolation

  Materials
  • Cultured mammalian cells: 1× 107 cells per experiment
  • Phosphate‐buffered saline (PBS; Life Technologies, cat. no. 10010‐023)
  • Cytoplasmic lysis buffer (see recipe)
  • Sucrose buffer (see recipe)
  • Nuclei wash buffer (see recipe)
  • Glycerol buffer (see recipe)
  • Nuclei lysis buffer (see recipe)
  • TRI reagent (MRC, cat. no. TR 118)
  • Chloroform (Sigma, cat. no. 288306)
  • RLT buffer (Qiagen, cat. no. 79216)
  • 100% (v/v) ethanol (VWR, cat. no. V1016)
  • RNeasy Mini Kit (Qiagen, cat. no.74104)
  • RNase‐Free DNase Set (Qiagen, cat. no. 79254)
  • RNase/DNase‐free H 2O (Life Technologies, cat. no. 10977‐015)
  • Antibodies (optional; for monitoring the experiment by western blotting):
    • Pol II Ser‐2P antibody (3E8; Active Motif, cat. no. 61083)
    • Histone 2B antibody (FL‐126; Santa Cruz Biotechnology, cat. no. sc‐10808)
    • U1 snRNP70 antibody(C‐18; Santa Cruz Biotechnology, cat. no. sc‐9571)
    • GAPDH antibody (6C5; Life Technologies, cat. no. AM4300)
  • Cell scrapers
  • Refrigerated centrifuge
  • Additional reagents and equipment for basic cell culture techniques including counting cells (Phelan & May, ) and for western blotting (immunoblotting; unit 10.8, Ni., Xu, and Gallagher, )

Basic Protocol 2: Sequencing Library Preparation

  Materials
  • RNA ( protocol 1)
  • Ribo‐Zero rRNA Removal Kit (Epicentre, cat. no. MRZH116)
  • 80% (v/v) ethanol (VWR, cat. no. V1016)
  • RNase/DNase‐free H 2O (Life Technologies, cat. no. 10977‐015)
  • 50% PEG8000 (supplied with the truncated T4 RNA Ligase 2; NEB, cat. no. M0242S)
  • Dimethylsulfoxide (DMSO; Sigma, cat. no. D8418)
  • T4 RNA Ligase buffer, 10× (supplied with the truncated T4 RNA Ligase 2; NEB, cat. no. M0242S)
  • EDTA (0.5 M; Life Technologies, cat. no. AM9260G)
  • Alkaline fragmentation solution (see recipe)
  • RNA precipitation solution (see recipe)
  • RNA control ladder (0.1 to 2 kb; Life Technologies, cat. no. 15623‐100)
  • oGAB11 control (Table 4.29.1)
  • 2× TBU denaturing loading buffer (Life Technologies, cat. no. LC6876)
  • TBE‐urea gels, 15% (w/v) (Life Technologies, cat. no. EC68852BOX)
  • Gel staining solution (see recipe)
  • GlycoBlue (15 mg/ml; Life Technologies, cat. no. AM9515)
  • Sodium acetate, RNase‐free (3 M, pH 5.5; Life Technologies, cat. no. AM9740)
  • Isopropanol (Sigma, cat. no. 278475)
  • T4 PNK buffer, 10× (supplied with T4 Polynucleotide Kinase, NEB, cat. no. M0201S)
  • SUPERase.In (20 U/µl; Life Technologies, cat. no. AM2696)
  • T4 Polynucleotide Kinase (10,000 U/ml; NEB, cat. no. M0201S)
  • DNA linker‐1 (Table 4.29.1)
  • T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S)
  • 5× First‐Strand Buffer (part of SuperScript III First‐Strand Synthesis System; Life Technologies, cat. no. 18080‐051)
  • dNTP mix (10 mM each dNTP; Life Technologies, cat. no. 18427‐013)
  • DTT (0.1 M; part of the SuperScript III First‐Strand Synthesis System, Life Technologies, cat. no. 18080‐051)
  • SUPERase.IN/DTT mix (see recipe)
  • 200 U/µl SuperScript III First‐Strand Synthesis System (Life Technologies, cat. no. 18080‐051)
  • 1 N NaOH
  • 1 N HCl
  • DNA control ladder (10 bp; Life Technologies, cat. no. 10821‐015)
  • TBE‐urea gels, 10% (w/v) (Life Technologies, cat. no. EC68752BOX)
  • TBE buffer, 10× (Life Technologies, cat. no. 15581‐044)
  • Gel staining solution (see recipe)
  • 5 M NaCl
  • 10 mM Tris⋅Cl, pH 8.0 ( appendix 22)
  • CircLigase reaction buffer, 10× (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K)
  • ATP, 1 mM (supplied with CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K)
  • MnCl 2, 50 mM (supplied with CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K)
  • CircLigase ssDNA Ligase (100 U/µl; Epicentre, cat. no. CL4111K)
  • Phusion HF Buffer, 5× (supplied with Phusion High‐Fidelity DNA Polymerase, NEB, cat. no. M0530S)
  • Illumina index primer (for example Barcode 4 Illumina index primer: AATGATACGGCGACCACCGAGATCTACACGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCATCCGACGATCATTGATGG)
  • Phusion DNA Polymerase (2,000 U/ml; NEB, cat. no. M0530S)
  • 6× DNA loading dye (unit 10.2; Gallagher, )
  • TBE gels, 8% (w/v) (Life Technologies, cat. no. EC62152BOX)
  • DNA soaking buffer (see recipe)
  • Qubit dsDNA HS Assay Kit (Life Technologies, cat. no. Q32851)
  • High Sensitivity Bioanalyzer DNA Analysis Kit (Agilent Technologies, cat. no. 5067‐4626)
Table 4.9.1   MaterialsDNA and RNA Oligos Required for the Preparation of Subcellular RNA‐Seq Libraries

DNA oligos
Linker‐1 /5rApp/CTGTAGGCACCATCAAT/3ddC
oLSC007 (RT primer) /5Phos/ATCTCGTATGCCGTCTTCTGCTTG/iSp18/CA CTCA/iSp18/TCCGACGATCATTGATGGTGCCTACAG
oNTI231 (reverse primer) CAAGCAGAAGACGGCATACGA
oLSC006 (sequencing primer) TCCGACGATCATTGATGGTGCCTACAG
RNA oligos
oGAB11 (control oligo) agucacuuagcgauguacacugacugug
oGAB11‐P f agucacuuagcgauguacacugacugug/3Phos/

 a5rApp: 5′‐riboadenylate.
 b3ddC: 3′‐dideoxycytidine.
 cCommercially available from Integrated DNA Technologies.
 d5Phos: 5′‐phosphate.
 eiSp18: internal 18‐atom hexa‐ethylenglycol spacer.
 f3Phos: 3′‐phosphate.
  • Refrigerated centrifuge
  • Thermomixer
  • Thermal cycler
  • Blue or UV light source
  • Scalpels (Electron Microscopy Sciences, cat. no. 72042‐11)
  • 0.5‐ml and 1.5‐ml RNase/DNase‐free non‐stick microcentrifuge tubes
  • 20‐G needle (BD, cat. no. 305175)
  • Microcentrifuge tube filter: Costar Spin‐X centrifuge tube filters (Sigma, cat. no. CLS8162‐96EA)
  • 0.2‐ml PCR tubes
  • Additional reagents and equipment for polyacrylamide gel electrophoresis (unit 10.2; Gallagher, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Bhatt, D. M., Pandya‐Jones, A., Tong, A.‐J., Barozzi, I., Lissner, M. M., Natoli, G., … Smale, S. T. (2012). Transcript dynamics of proinflammatory genes revealed by sequence analysis of subcellular RNA fractions. Cell, 150, 279–290. doi: 10.1016/j.cell.2012.05.043.
  Brueckner, F., & Cramer, P. (2008). Structural basis of transcription inhibition by α‐amanitin and implications for RNA polymerase II translocation. Nature Structural & Molecular Biology, 15, 811–818. doi: 10.1038/nsmb.1458.
  Cai, H., & Luse, D. S. (1987). Transcription initiation by RNA polymerase II in vitro. The Journal of Biological Chemistry, 262, 298–304.
  Churchman, L. S., & Weissman, J. S. (2012a). Nascent transcript sequencing visualizes transcription at nucleotide resolution. Nature, 469, 368–373. doi: 10.1038/nature09652.
  Churchman, L. S., & Weissman, J. S. (2012b). Native elongating transcript sequencing (NET‐seq). Current Protocols in Molecular Biology, 98, 4.14.1–4.14.17. doi: 10.1002/0471142727.mb0414s98.
  Conrad, T., Marsico, A., Gehre, M., & Ørom, U. A. (2014). Microprocessor activity controls differential miRNA biogenesis in vivo. Cell Reports, 9, 542–554. doi: 10.1016/j.celrep.2014.09.007.
  Djebali, S., Davis, C. A., Merkel, A., Dobin, A., Lassmann, T., Mortazavi, A., … Gingeras, T. R. (2013). Landscape of transcription in human cells. Nature, 488, 101–108.
  Ferrari, F., Plachetka, A., Alekseyenko, A. A., Jung, Y. L., Ozsolak, F., Kharchenko, P. V., … Kuroda, M. I. (2013). “‘Jump start and gain” model for dosage compensation in drosophila based on direct sequencing of nascent transcripts. Cell Reports, 5, 629–636. doi: 10.1016/j.celrep.2013.09.037.
  Gallagher, S. R. (2012). One‐dimensional SDS gel electrophoresis of proteins. Current Protocols in Molecular Biology, 97, 10.2A.1–10.2A.44. doi: 10.1002/0471142727.mb1002as97.
  Ingolia, N. T., Brar, G. A., Rouskin, S., McGeachy, A. M., & Weissman, J. S. (2013). Genome‐wide annotation and quantitation of translation by ribosome profiling. Current Protocols in Molecular Biology, 103, 4.18:4.18.1–4.18.19. doi: 10.1002/0471142727.mb0418s103.
  Ingolia, N. T., Brar, G. A., Rouskin, S., McGeachy, A. M., & Weissman, J. S. (2012). The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome‐protected mRNA fragments. Nature Protocols, 7, 1534–1550. doi: 10.1038/nprot.2012.086.
  Jensen, T. H., Jacquier, A., & Libri, D. (2013). Dealing with pervasive transcription. Molecular Cell, 52, 473–484. doi: 10.1016/j.molcel.2013.10.032.
  Jonkers, I., & Lis, J. T. (2015). Getting up to speed with transcription elongation by RNA polymerase II. Nature Reviews Molecular Cell Biology, 16, 167–177. doi: 10.1038/nrm3953.
  Khodor, Y. L., Rodriguez, J., Abruzzi, K. C., Tang, C. H. A., Marr, M. T., & Rosbash, M. (2011). Nascent‐seq indicates widespread cotranscriptional pre‐mRNA splicing in Drosophila. Genes & Development, 25, 2502–2512. doi: 10.1101/gad.178962.111.
  Kilchert, C., Wittmann, S., & Vasiljeva, L. (2016). The regulation and functions of the nuclear RNA exosome complex. Nature Reviews Molecular Cell Biology, 17, 227–239. doi: 10.1038/nrm.2015.15.
  Lindell, T. J., Weinberg, F., Morris, P. W., Roeder, R. G., & Rutter, W. J. (1970). Specific inhibition of nuclear RNA polymerase II by alpha‐amanitin. Science, 170, 447–449. doi: 10.1126/science.170.3956.447.
  Mayer, A., & Churchman, L. S. (2016). Genome‐wide profiling of RNA polymerase transcription at nucleotide resolution in human cells with native elongating transcript sequencing. Nature Protocols, 11, 813–833. doi: 10.1038/nprot.2016.047.
  Mayer, A., Di Iulio, J., Maleri, S., Eser, U., Vierstra, J., Reynolds, A., … Churchman, L. S. (2015). Native elongating transcript sequencing reveals human transcriptional activity at nucleotide resolution. Cell, 161, 541–554. doi: 10.1016/j.cell.2015.03.010.
  Meinel, D. M., & Sträßer, K. (2015). Co‐transcriptional mRNP formation is coordinated within a molecular mRNP packaging station in S. cerevisiae. BioEssays, 37, 666–677. doi: 10.1002/bies.201400220.
  Mondal, T., Rasmussen, M., Pandey, G. K., Isaksson, A., & Kanduri, C. (2010). Characterization of the RNA content of chromatin. Genome Research, 20, 899–907. doi: 10.1101/gr.103473.109.
  Ni, D., Xu, P., and Gallagher, S. (2016). Immunoblotting and immunodetection. Current Protocols Molecular Biology, 114, 10.8.1‐10.8.37. doi: 10.1002/0471142727.mb1008s114
  Oeffinger, M., & Zenklusen, D. (2012). To the pore and through the pore: a story of mRNA export kinetics. Biochimica et Biophysica Acta, 1819, 494–506.
  Padovan‐Merhar, O., Nair, G. P., Biaesch, A. G., Mayer, A., Scarfone, S., Foley, S. W., … Raj, A. (2015). Single mammalian cells compensate for differences in cellular volume and DNA copy number through independent global transcriptional mechanisms. Molecular Cell, 58, 339‐352. doi: 10.1016/j.molcel.2015.03.005.
  Pandya‐Jones, A., & Black, D. L. (2009). Co‐transcriptional splicing of constitutive and alternative exons. RNA, 15, 1896–1908. doi: 10.1261/rna.1714509.
  Pelechano, V., & Steinmetz, L. M. (2013). Gene regulation by antisense transcription. Nature Reviews Genetics, 14, 880–893. doi: 10.1038/nrg3594.
  Phelan, K., & May, K. M. (2017). Mammalian cell tissue culture techniques. Currrent Protocols in Molecular Biology, 117, A.3F.1–A.3F.23. doi: 10.1002/cpmb.31.
  Tilgner, H., Knowles, D. G., Johnson, R., Davis, C. A., Chakrabortty, S., Djebali, S., … Guigo, R. (2012). Deep sequencing of subcellular RNA fractions shows splicing to be predominantly co‐transcriptional in the human genome but inefficient for lncRNAs. Genome Research, 22, 1616–1625. doi: 10.1101/gr.134445.111.
  Venkatesh, S., & Workman, J. L. (2015). Histone exchange, chromatin structure and the regulation of transcription. Nature Reviews Molecular Cell Biology, 16, 1–12. doi: 10.1038/nrm3941.
  Wang, Z., Gerstein, M., & Snyder, M. (2009). RNA‐Seq: A revolutionary tool for transcriptomics. Nature Reviews Genetics, 10, 57–63. doi: 10.1038/nrg2484.
  Weber, C. M., Ramachandran, S., & Henikoff, S. (2014). Nucleosomes are context‐specific, H2A.Z‐modulated barriers to RNA polymerase. Molecular Cell, 53, 819–830. doi: 10.1016/j.molcel.2014.02.014.
  Wickramasinghe, V. O., & Laskey, R. A. (2015). Control of mammalian gene expression by selective mRNA export. Nature Reviews Molecular Cell Biology, 16, 431–442. doi: 10.1038/nrm4010.
  Wuarin, J., & Schibler, U. (1994). Physical isolation of nascent RNA chains transcribed by RNA polymerase II: Evidence for cotranscriptional splicing. Molecular and Cellular Biology, 14, 7219–7225. doi: 10.1128/MCB.14.11.7219.
  Zaghlool, A., Ameur, A., Nyberg, L., Halvardson, J., Grabherr, M., Cavelier, L., & Feuk, L. (2013). Efficient cellular fractionation improves RNA sequencing analysis of mature and nascent transcripts from human tissues. BMC Biotechnology, 13, 99. doi: 10.1186/1472‐6750‐13‐99.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library