Evolving Aptamers with Unnatural Base Pairs

Michiko Kimoto1, Ken‐ichiro Matsunaga1, Ichiro Hirao1

1 Institute of Bioengineering and Nanotechnology, Singapore
Publication Name:  Current Protocols in Chemical Biology
Unit Number:   
DOI:  10.1002/cpch.31
Online Posting Date:  December, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

A novel technology, genetic alphabet expansion, has rapidly advanced through the successful creation of unnatural base pairs that function as a third base pair in replication. Recently, genetic alphabet expansion has been applied to some practical areas. Among them, the application to DNA aptamer generation is a good example of the broad utility of this technology. A hydrophobic unnatural base pair, Ds–Px, which exhibits high fidelity in replication as a third base pair, has been applied to an evolutionary engineering method called SELEX (Systematic Evolution of Ligands by EXponential enrichment) to generate DNA aptamers that bind to targets. A few Ds bases in DNA aptamers significantly increase the binding affinity to targets, enabling the use of DNA aptamers as an alternative to antibodies. This protocol describes the ExSELEX (genetic alphabet Expansion for SELEX) method to generate Ds‐containing DNA aptamers. © 2017 by John Wiley & Sons, Inc.

Keywords: DNA aptamer; ExSELEX; genetic alphabet expansion; SELEX; unnatural base pair

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Preparation of DNA Library with a Random Sequence Containing the Unnatural Bases
  • Basic Protocol 2: Selection of DNA Species that Bind to a Target Protein
  • Basic Protocol 3: PCR Amplification of the Isolated Ds‐Containing DNA
  • Basic Protocol 4: Binding Analysis of the Enriched DNA Library by Gel‐Shift Assays
  • Basic Protocol 5: Prepartion of DNA Templates for Sequencing
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of DNA Library with a Random Sequence Containing the Unnatural Bases

  Materials
  • Nuclease‐free, deionized, and sterile water
  • 8% (19:1) polyacrylamide gel containing 7 M urea (20 cm × 40 cm, 2‐mm thick, 6‐well) (see recipe)
  • 1× TBE (see recipe)
  • Chemically synthesized Ds‐containing DNA sub‐libraries (200 nmol scale synthesis, 81‐nts): The sequence, 5′‐CCGTTCTCTAATTTTGACGTT XXXA CT NNNNNnnnnnnnnnnnnnnnnNNNNN AGTYYY AGGGTCTGTATCGCAATAATT‐3′, consists of the 5′‐primer part, 5′‐stem (XXXACT), 26‐nt randomized (N = A, G, C, or T; n = Ds or N) part, 3′‐stem (AGTYYY), and 3′‐primer part regions (Fig.  ) (in each sub‐library, the XXX and YYY sequences are used as a bar‐code to identify the predetermined Ds positions)
  • Denaturing loading dye solution (see recipe)
  • Marker dye solution (see recipe)
  • 3 M sodium acetate, pH 5.2 (NaOAc)
  • 100% and 70% ethanol, −20°C
  • Polyacrylamide gel electrophoretic apparatus with a heat dissipation plate (BIO CRAFT, BE‐620 or BE‐622)
  • Power supply (Bio‐Rad PowerPac 3000 with a temperature probe)
  • 75°C heating block
  • Small plastic dropper
  • Spatula
  • Plastic wrap
  • Thin‐layer chromatography (TLC) plate containing a UV fluorescent indicator
  • Handheld UV lamp (254‐nm)
  • Razor blade
  • 50‐ml conical tubes
  • Incubator with shaker
  • 0.22‐µm filter units (Steriflip, Millipore)
  • Vacuum pump
  • 5‐ml tubes
  • Vortex mixer
  • Refrigerated centrifuge
  • SpeedVac concentrator
  • DNA LoBind 1.5‐ml tubes (Eppendorf)
  • UV spectrophotometer

Basic Protocol 2: Selection of DNA Species that Bind to a Target Protein

  Materials
  • Nuclease‐free, deionized, and sterile water
  • N26Ds DNA library (see protocol 1)
  • 10× phosphate‐buffered saline (PBS), pH 7.4 (Gibco)
  • Ice
  • 0.5% (w/v) Nonidet P‐40
  • Recombinant vWF‐A1 domain, human, residues 1261–1468 (U‐Protein Express BV)
  • EZ‐Link Sulfo‐NHS‐LC‐Biotin (Thermo Fisher Scientific)
  • 2 M Glycine (see recipe)
  • 1× Binding buffer (see recipe)
  • Hydrophilic streptavidin magnetic beads, 4 mg/ml (New England Biolabs)
  • 50 mM NaOH
  • Dowex (H+) slurry (see recipe)
  • 1 M Tris·Cl, pH 7.4
  • DNA LoBind 1.5‐ml tubes (Eppendorf)
  • 95°C heating block
  • Amicon Ultra‐0.5 Centrifugal Filter Units with Ultracel‐30 membrane (Merck)
  • Centrifuge
  • Incubator with shaker
  • Magnetic separation rack
  • Tube rotator
  • 0.22‐µm Ultrafree‐MC filter units (Merck)
  • Vortex mixer

Basic Protocol 3: PCR Amplification of the Isolated Ds‐Containing DNA

  Materials
  • 2.5 U/µl AccuPrime Pfx DNA polymerase with 10× AccuPrime Pfx Reaction mix and 50 mM MgSO 4 (Life Technologies)
  • 20 µM Dss‐forward primer: 5′‐Dss‐ACGACCGTTCTCTAATTTTGACGTT‐3′
  • 20 µM linker‐reverse primer: 5′ ‐TTTTTTTTTTTTTTT‐L‐ACCAAATTATTGCGATACAGACCCT‐3′ (L: Spacer C12 Phosphoramidite)
  • 10 mM each dNTP mix (see recipe)
  • 0.5 mM dDsTP
  • 0.5 mM dPxTP
  • 1/7,500‐diluted SYBR Green I (see recipe)
  • Ds‐containing DNA solution recovered from the complex (around 200 µl) (see protocol 2)
  • 4% Agarose gel containing ethidium bromide
  • 1× TBE (see recipe)
  • Agarose gel loading buffer (see recipe)
  • 25‐bp DNA step ladder (Promega)
  • 8% (19:1) polyacrylamide gel containing 7 M urea (16 cm × 16 cm, 2‐mm thick) (see recipe)
  • Denaturing loading dye solution (see recipe)
  • Marker dye solution (see recipe)
  • 3 M NaOAc, pH 5.2
  • 100% and 70% ethanol, −20°C
  • Thin‐wall 0.2‐ml PCR tubes
  • Thermal cycler
  • DNA LoBind 1.5‐ml tubes (Eppendorf)
  • Electrophoretic apparatus for agarose gel
  • Power supply
  • CFX96 qPCR instrument (Bio‐Rad) or any other qPCR instrument that can detect SYBR Green I signals
  • LAS4000 bio‐imager, or a similar gel imaging system capable of DNA‐stained gel detection
  • Electrophoretic apparatus for denaturing polyacrylamide gel (BE‐130, one face cooling type, BIO CRAFT Co., Ltd.)
  • 75°C heating block
  • Small plastic dropper
  • Spatula
  • Plastic wrap
  • TLC plate containing a UV fluorescent indicator
  • Handheld dual‐UV lamp (254 nm and 365 nm)
  • Razor blade
  • 2‐ml tubes
  • Incubator with shaker
  • 0.22‐µm Ultrafree‐CL filter units (Millipore)
  • Vacuum pump
  • Refrigerated microcentrifuge
  • 5‐ml tubes
  • Vortex mixer
  • SpeedVac concentrator
  • UV spectrophotometer

Basic Protocol 4: Binding Analysis of the Enriched DNA Library by Gel‐Shift Assays

  Materials
  • 1 µM each of PCR‐amplified and gel‐purified Ds‐DNA libraries after each round of selection (see Basic Protocols protocol 11 and protocol 33)
  • 1 µM ARC1172: 5′‐GGCGTGCAGTGCCTTCGGCCGTGCGGTGCCTCCGTCACGCC‐3′
  • 10× phosphate‐buffered saline (PBS), pH 7.4 (Gibco)
  • Ice
  • 0.05% (w/v) Nonidet P‐40 in 1× PBS
  • 200 nM vWF‐A1 solution (diluted with 1× binding buffer before use)
  • 1× binding buffer (see recipe)
  • 8% (29:1) polyacrylamide‐5% glycerol gel with or without urea (16 cm × 16 cm, 1‐mm thick) (see recipe)
  • 0.5 × TBE (see recipe)
  • Gel‐shift loading buffer (see recipe)
  • Diluted SYBR Gold solution (see recipe)
  • 95°C heating block
  • Incubator
  • Polyacrylamide gel electrophoretic apparatus (BIO CRAFT)
  • Power supply
  • Small plastic dropper
  • Spatula
  • Shaker
  • LAS4000 bio‐imager, or a similar gel imaging system capable of DNA‐stained gel detection

Basic Protocol 5: Prepartion of DNA Templates for Sequencing

  Materials
  • Nuclease‐free, deionized, and sterile water
  • 2.5 U/µl AccuPrime Pfx DNA polymerase with 10× AccuPrime Pfx Reaction mix and 50 mM MgSO 4 (Life Technologies)
  • 20 µM forward primer: 5′‐ACGACCGTTCTCTAATTTTGACGTT‐3′
  • 20 µM reverse primer: 5′‐ACCAAATTATTGCGATACAGACCCT‐3′
  • 10 mM each dNTP mix (see recipe)
  • 0.5 mM dPa'TP
  • 100 nM Ds‐containing DNA library (see protocol 3)
  • 4% Agarose gel containing ethidium bromide
  • 1× TBE (see recipe)
  • Agarose gel loading buffer (see recipe)
  • 25‐bp DNA step ladder (Promega)
  • QIAquick Gel Extraction Kit (QIAGEN)
  • 0.2‐ml thin‐walled PCR tubes
  • Thermal cycler
  • Electrophoretic apparatus for agarose gel
  • Power supply
  • LAS4000 bio‐imager, or a similar gel imaging system capable of DNA‐stained gel detection
  • UV spectrophotometer
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Bell, N. M., & Micklefield, J. (2009). Chemical modification of oligonucleotides for therapeutic, bioanalytical and other applications. Chembiochem, 10, 2691–2703. doi: 10.1002/cbic.200900341.
  Benner, S. A. (2004). Understanding nucleic acids using synthetic chemistry. Accounts of Chemical Research, 37, 784–797. doi: 10.1021/ar040004z.
  Benner, S. A., Karalkar, N. B., Hoshika, S., Laos, R., Shaw, R. W., Matsuura, M., … Moussatche, P. (2016). Alternative Watson‐Crick synthetic genetic systems. Cold Spring Harbor Perspectives in Biology, 8(11), a023770. doi: 10.1101/cshperspect.a023770.
  Biondi, E., Lane, J. D., Das, D., Dasgupta, S., Piccirilli, J. A., Hoshika, S., … Benner, S. A. (2016). Laboratory evolution of artificially expanded DNA gives redesignable aptamers that target the toxic form of anthrax protective antigen. Nucleic Acids Research, 44, 9565–9577. doi: 10.1093/nar/gkw890
  Diafa, S., & Hollenstein, M. (2015). Generation of Aptamers with an expanded chemical repertoire. Molecules, 20, 16643–16671. doi: 10.3390/molecules200916643.
  Ellington, A. D., & Szostak, J. W. (1990). In vitro selection of RNA molecules that bind specific ligands. Nature, 346, 818–822. doi: 10.1038/346818a0.
  Hirao, I., & Kimoto, M. (2012). Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma. Proceedings of the Japan Academy. Series B, Physical and Biological Sciences, 88, 345–367. doi: 10.2183/pjab.88.345.
  Hirao, I., Kimoto, M., Mitsui, T., Fujiwara, T., Kawai, R., Sato, A., … Yokoyama, S. (2006). An unnatural hydrophobic base pair system: Site‐specific incorporation of nucleotide analogs into DNA and RNA. Nature Methods, 3, 729–735. doi: 10.1038/nmeth915.
  Hirao, I., Ohtsuki, T., Fujiwara, T., Mitsui, T., Yokogawa, T., Okuni, T., … Yokoyama, S. (2002). An unnatural base pair for incorporating amino acid analogs into proteins. Nature Biotechnology, 20, 177–182. doi: 10.1038/nbt0202‐177.
  Houlihan, G., Arangundy‐Franklin, S., & Holliger, P. (2017). Engineering and application of polymerases for synthetic genetics. Current Opinion in Biotechnology, 48, 168–179. doi: 10.1016/j.copbio.2017.04.004.
  Huang, R. H., Fremont, D. H., Diener, J. L., Schaub, R. G, & Sadler, J. E. (2009). A structural explanation for the antithrombotic activity of ARC1172, a DNA aptamer that binds von Willebrand factor domain A1. Structure, 17, 1476–1484. doi: 10.1016/j.str.2009.09.011.
  Jung, C., & Ellington, A. D. (2015). Synthetic biology: Six pack and stack. Nature Chemistry, 7, 617–619. doi: 10.1038/nchem.2313.
  Keefe, A. D., & Cload, S. T. (2008). SELEX with modified nucleotides. Current Opinion in Chemical Biology, 12, 448–456. doi: 10.1016/j.cbpa.2008.06.028.
  Kimoto, M., Kawai, R., Mitsui, T., Yokoyama, S., & Hirao, I. (2009). An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules. Nucleic Acids Research, 37, e14. doi: 10.1093/nar/gkn956.
  Kimoto, M., Matsunaga, K., & Hirao, I. (2016a). DNA Aptamer generation by genetic alphabet expansion SELEX (ExSELEX) using an unnatural base pair system. Methods in Molecular Biology, 1380, 47–60. doi: 10.1007/978‐1‐4939‐3197‐2_4.
  Kimoto, M., Mitsui, T., Yamashige, R., Sato, A., Yokoyama, S., & Hirao, I. (2010). A new unnatural base pair system between fluorophore and quencher base analogues for nucleic acid‐based imaging technology. Journal of the American Chemical Society, 132, 15418–15426. doi: 10.1021/ja1072383.
  Kimoto, M., Nakamura, M., & Hirao, I. (2016b). Post‐ExSELEX stabilization of an unnatural‐base DNA aptamer targeting VEGF165 toward pharmaceutical applications. Nucleic Acids Research, 44, 7487–7494. doi: https://doi.org/10.1093/nar/gkw619.
  Kimoto, M., Yamashige, R., Matsunaga, K., Yokoyama, S., & Hirao, I. (2013). Generation of high‐affinity DNA aptamers using an expanded genetic alphabet. Nature Biotechnology, 31, 453–457. doi: 10.1038/nbt.2556.
  Lapa, S. A., Chudinov, A. V., & Timofeev, E. N. (2016). The toolbox for modified aptamers. Molecular Biotechnology, 58, 79–92. doi: 10.1007/s12033‐015‐9907‐9.
  Li, L., Degardin, M., Lavergne, T., Malyshev, D. A., Dhami, K., Ordoukhanian, P., & Romesberg, F. E. (2014). Natural‐like replication of an unnatural base pair for the expansion of the genetic alphabet and biotechnology applications. Journal of the American Chemical Society, 136, 826–829. doi: 10.1021/ja408814g.
  Lutz, M. J., Horlacher, J., & Benner, S. A. (1998). Recognition of a non‐standard base pair by thermostable DNA polymerases. Bioorganic & Medicinal Chemistry Letters, 8, 1149–1152. doi: 10.1016/S0960‐894X(98)00177‐2.
  Malyshev, D. A., Dhami, K., Lavergne, T., Chen, T., Dai, N., Foster, J. M., … Romesberg, F. E. (2014). A semi‐synthetic organism with an expanded genetic alphabet. Nature, 509, 385–388. doi: 10.1038/nature13314.
  Malyshev, D. A., Dhami, K., Quach, H. T., Lavergne, T., Ordoukhanian, P., Torkamani, A., & Romesberg, F. E. (2012). Efficient and sequence‐independent replication of DNA containing a third base pair establishes a functional six‐letter genetic alphabet. Proceedings of the National Academy of Sciences of the United States America, 109, 12005–12010. doi: 10.1073/pnas.1205176109.
  Malyshev, D. A., & Romesberg, F. E. (2015). The expanded genetic alphabet. Angewandte Chemie (International ed. in English), 54, 11930–11944. doi: 10.1002/anie.201502890.
  Malyshev, D. A., Seo, Y. J., Ordoukhanian, P., & Romesberg, F. E. (2009). PCR with an expanded genetic alphabet. Journal of the American Chemical Society, 131, 14620–14621. doi: 10.1021/ja906186f.
  Matsunaga, K., Kimoto, M., Hanson, C., Sanford, M., Young, H. A., & Hirao, I. (2015). Architecture of high‐affinity unnatural‐base DNA aptamers toward pharmaceutical applications. Scientific Reports, 5, 18478. doi: 10.1038/srep18478.
  Matsunaga, K., Kimoto, M., & Hirao, I. (2017). High‐affinity DNA aptamer generation targeting von willebrand factor A1‐domain by genetic alphabet expansion for systematic evolution of ligands by exponential enrichment using two types of libraries composed of five different bases. Journal of the American Chemical Society, 139, 324–334. doi: 10.1021/jacs.6b10767.
  McMinn, D. L., Ogawa, A. K., Wu, Y., Liu, J., Schultz, P. G., & Romesberg, F. E. (1999). Efforts toward expansion of the genetic alphabet: DNA polymerase recognition of a highly stable, self‐pairing hydrophobic base. Journal of the American Chemical Society, 121, 11585–11586. doi: 10.1021/ja9925150.
  Morales, J. C., & Kool, E. T. (1998). Efficient replication between non‐hydrogen‐bonded nucleoside shape analogs. Nature Structural Biology, 5, 950–954. doi: 10.1038/2925.
  Okamoto, I., Miyatake, Y., Kimoto, M., & Hirao, I. (2016). High fidelity, efficiency and functionalization of Ds‐Px unnatural base pairs in PCR amplification for a genetic alphabet expansion system. ACS Synthetic Biology, 5, 1220–1230. doi: 10.1021/acssynbio.5b00253
  Rich, A. (1962). Problems of evolution and biochemical information transfer. In M. Kasha & B. Pullman (Eds.), Horizons Biochem (pp. 103–126). Academic Press.
  Robinson, H., Gao, Y. G., Bauer, C., Roberts, C., Switzer, C., & Wang, A. H. (1998). 2′‐Deoxyisoguanosine adopts more than one tautomer to form base pairs with thymidine observed by high‐resolution crystal structure analysis. Biochemistry, 37, 10897–10905. doi: 10.1021/bi980818l.
  Sefah, K., Yang, Z., Bradley, K. M., Hoshika, S., Jimenez, E., Zhang, L., … Benner, S. A. (2014). In vitro selection with artificial expanded genetic information systems. Proceedings of the National Academy of Sciences of the United States of America, 111, 1449–1454. doi: 10.1073/pnas.1311778111.
  Sherrill, C. B., Marshall, D. J., Moser, M. J., Larsen, C. A., Daude‐Snow, L., Jurczyk, S., … Prudent, J. R. (2004). Nucleic acid analysis using an expanded genetic alphabet to quench fluorescence. Journal of the American Chemical Society, 126, 4550–4556. doi: 10.1021/ja0315558.
  Switzer, C., Moroney, S. E., & Benner, S. A. (1989). Enzymatic incorporation of a new base pair into DNA and RNA. Journal of the American Chemical Society, 111, 8322–8323. doi: 10.1021/ja00203a067.
  Switzer, C. Y., Moroney, S. E., & Benner, S. A. (1993). Enzymatic recognition of the base pair between isocytidine and isoguanosine. Biochemistry, 32, 10489–10496. doi: 10.1021/bi00090a027.
  Tuerk, C., & Gold, L. (1990). Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science, 249, 505–510. doi: 10.1126/science.2200121.
  Yamashige, R., Kimoto, M., Takezawa, Y., Sato, A., Mitsui, T., Yokoyama, S., & Hirao, I. (2012). Highly specific unnatural base pair systems as a third base pair for PCR amplification. Nucleic Acids Research, 40, 2793–2806. doi: 10.1093/nar/gkr1068.
  Yang, Y., Ren, X., Schluesener, H. J., & Zhang, Z. (2011a). Aptamers: Selection, modification and application to nervous system diseases. Current Medicinal Chemistry, 18, 4159–4168. doi: 10.2174/092986711797189646.
  Yang, Z., Chen, F., Alvarado, J. B., & Benner, S. A. (2011b). Amplification, mutation, and sequencing of a six‐letter synthetic genetic system. Journal of the American Chemical Society, 133, 15105–15112. doi: 10.1021/ja204910n.
  Yang, Z., Sismour, A. M., Sheng, P., Puskar, N. L., & Benner, S. A. (2007). Enzymatic incorporation of a third nucleobase pair. Nucleic Acids Research, 35, 4238–4249. doi: 10.1093/nar/gkm395.
  Zhang, L., Yang, Z., Le Trinh, T., Teng, I. T., Wang, S., Bradley, K. M., … Tan, W. (2016). Aptamers against cells overexpressing Glypican 3 from expanded genetic systems combined with cell engineering and laboratory evolution. Angewandte Chemie (International ed. in English), 55, 12372–12375. doi: 10.1002/anie.201605058.
  Zhang, L., Yang, Z., Sefah, K., Bradley, K. M., Hoshika, S., Kim, M. J., … Benner, S. A. (2015). Evolution of functional six‐nucleotide DNA. Journal of the American Chemical Society, 137, 6734–6737. doi: 10.1021/jacs.5b02251.
  Zhang, Y., Lamb, B. M., Feldman, A. W., Zhou, A. X., Lavergne, T., Li, L., & Romesberg, F. E. (2017). A semisynthetic organism engineered for the stable expansion of the genetic alphabet. Proceedings of the National Academy of Sciences of the United States of America, 114, 1317–1322. doi: 10.1073/pnas.1616443114.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library